Buffer rwt

Manufactured by Qiagen

Sourced in Netherlands, Germany, United States

Buffer RWT is a laboratory solution used in the purification of nucleic acids. It serves as a component in the RNA extraction and purification process, facilitating the effective binding of RNA to silica-based membranes or resins. The buffer's function is to provide the necessary chemical conditions for the efficient adsorption and recovery of RNA during the purification workflow.

Automatically generated - may contain errors

Lab products found in correlation

Buffer rpe, by Qiagen (4 mentions) Qiazol lysis reagent, by Qiagen (2 mentions) Rneasy plus mini kit, by Qiagen (2 mentions) Rneasy mini spin column, by Qiagen (2 mentions) Agilent 2100 bioanalyzer, by Agilent Technologies (2 mentions) Nanodrop, by Thermo Fisher Scientific (2 mentions) Rneasy minelute spin column, by Qiagen (1 mentions) Exorneasy midi kit, by Qiagen (1 mentions) Mircury rna spike in kit, by Qiagen (1 mentions) Mircury lna rt kit, by Qiagen (1 mentions) Econospin column for rna, by Ajinomoto Group (1 mentions) Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions) Thunderbird sybr qpcr mix, by Toyobo (1 mentions) Revertra ace qpcr rt master mix with gdna remover, by Toyobo (1 mentions) Centrifuge 5415r, by Eppendorf (1 mentions) Mirneasy serum plasma advanced kit, by Qiagen (1 mentions) Gdna eliminator spin column, by Qiagen (1 mentions) Qiashredder spin column, by Qiagen (1 mentions) Purelink rna mini kit, by Thermo Fisher Scientific (1 mentions) Ethanol, by Merck Group (1 mentions)

8 protocols using buffer rwt

Extracellular Vesicle RNA Extraction

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Normal single donor human plasma, frozen once, was obtained from Innovative Research (10 mL, #IPLA-N-S, Novi, MI, USA), and EVs extracted as described previously (Section 2.3 EV Extraction in Banack et al. [11 (link)]). We used the T−N fraction of the EV preparations for these experiments. T−N represents the total heterogeneous EV population minus the EVs positive for L1CAM/CD171 neural surface proteins, designated NEE [11 (link)].
The RNA extraction kit containing the RNeasy MinElute Spin Columns was from Qiagen (ExoRNeasy Midi Kit #77144, Hilden, Germany). The RNA Tini Spin columns were from Enzymax LLC (Lexington, KY, USA, #EZC107N). Although the RNeasy MinElute Spin Columns from Qiagen cannot be purchased as a separate item, the lysis and wash buffers used in the total RNA extraction process that retains short RNA (<200 nt) are available. QIAzol lysis reagent 50 mL #79306, Buffer RPE (concentrate 55 mL) # 1018013, Buffer RWT (80 mL) #1067933, miRCURY RNA spike-in kit, for RT (containing UniSp2, 4, 5 and cel-miR-39-3p) #339390, and the miRCURY LNA RT Kit containing UniSp6 #339340 were from Qiagen. Chloroform ≥99%, stabilized, molecular biology grade #0219400225 was from MP Biomedicals. Ethyl alcohol, pure 200 proof for molecular biology #E7023 (Lot #SHBJ8384), was from Sigma-Aldrich (St Louis, MO, USA).

Dunlop R.A., Banack S.A, & Cox P.A. (2021). A comparison of the efficiency of RNA extraction from extracellular vesicles using the Qiagen RNeasy MinElute versus Enzymax LLC RNA Tini Spin columns and qPCR of miRNA. Biology Methods & Protocols, 6(1), bpab015.

+ Open protocol

+ Expand

RNA Extraction and RT-qPCR Analysis in ARPE19 Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

We extracted RNA from the ARPE19 cell line using a TRI reagent® (MRC, Cincinnati, OH, USA) and an Econospin column for RNA (GeneDesign, Osaka, Japan). The columns were washed with Buffer RPE (Qiagen, Hilden, Netherlands) and Buffer RWT (Qiagen, Hilden, Netherlands). RNA was reverse-transcribed into cDNA using ReverTra Ace® qPCR RT Master Mix with gDNA remover (TOYOBO, Osaka, Japan) [21 (link)]. Real-time-PCR was performed using THUNDERBIRD® SYBR® qPCR Mix (TOYOBO, Osaka, Japan) with a StepOnePlus Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The relative amplification of cDNA fragments was calculated using the 2^−ΔΔCt method. Real-time PCR primer sequences were as follows: Vegf forward: TCTACCTCCACCATGCCAAGT, Vegf reverse: GATGATTCTGCCCTCCTCCTT, Glut1 forward: CGGGCCAAGAGTGTGCTAAA, Glut1 reverse: TGACGATACCGGAGCCAATG, Pdk1 forward: ACAAGGAGAGCTTCGGGGTGGATC, Pdk1 reverse: CCACGTCGCAGTTTGGATTTATGC, Bnip3 forward: GGACAGAGTAGTTCCAGAGGCAGTTC, Bnip3 reverse: GGTGTGCATTTCCACATCAAACAT, Gapdh forward: TCCCTGAGCTGAACGGGAAG, and Gapdh reverse, GGAGGAGTGGGTGTCGCTGT.

Ibuki M., Shoda C., Miwa Y., Ishida A., Tsubota K, & Kurihara T. (2019). Therapeutic Effect of Garcinia cambogia Extract and Hydroxycitric Acid Inhibiting Hypoxia-Inducible Factor in a Murine Model of Age-Related Macular Degeneration. International Journal of Molecular Sciences, 20(20), 5049.

+ Open protocol

+ Expand

Total RNA Isolation from Human Serum

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from human serum samples using the miRNeasy Serum/Plasma Advanced Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instruction. Afterwards 300 μl serum was transferred into a 2 ml microcentrifuge tube, 90 μl buffer RPL (Qiagen, Hilden, Germany), which contains guanidine thiocyanate as well as detergents, was added, vortexed and incubated at room temperature (RT) for 3 min. To precipitate inhibitors (mostly proteins that are highly concentrated in serum samples), 90 μl buffer RPP was added, mixed vigorously followed by an incubation of 3 min at RT. Samples were centrifuged for 3 min at 12000 x g (Eppendorf Centrifuge 5415 R, Hamburg, Germany) at RT until complete phase separation. The aqueous phase, containing total RNA, was precipitated with one volume (350–375 μl) 100% isopropanol. In a next step, the entire sample was transferred to a RNeasy UCP MinElute column and centrifuged for 15 s at 8000 x g. 700 μl buffer RWT (Qiagen, Hilden, Germany) was added, followed by centrifugation for 15 s at 8000 x g RT. Afterwards, 500 μl 80% ethanol were added, followed by centrifugation at RT for 15 s at 8000 x g. Total RNA was eluted with 20 μl RNase-free water and stored at −80 °C.

Hellberg T., Mohr R., Geisler L., Knorr J., Wree A., Demir M., Benz F., Lambrecht J., Loosen S.H., Tacke F., Roderburg C., Jann H, & Özdirik B. (2020). Serum levels of miR-223 but not miR-21 are decreased in patients with neuroendocrine tumors. PLoS ONE, 15(12), e0244504.

+ Open protocol

+ Expand

Comprehensive RNA Extraction from Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted was extracted from cells using a PureLink RNA Mini Kit (Ambion) using the manufacturer’s protocol with several modifications. Cell lysates were homogenized using QIAshredder spin columns (Qiagen). Two distinct methods were used to remove genomic DNA during the RNA purification: (1) homogenized lysates were filtered through a gDNA eliminator spin columns (Qiagen) and (2) on-column DNase treatment (Qiagen). The chemistry behind silica-membrane spin column-based RNA purification necessitates ethanol concentrations ≥50% (final concentration) during precipitation and wash steps in order to obtain RNA from approximately 18 nucleotides (nt) upwards. Thus, to extract all species of RNA, including those <200 nt such as miRNA, after homogenized lysates were passed through gDNA eliminator spin columns, 100% ethanol (Sigma) was used to precipitate RNA out of solution (final ethanol concentration of 50%). To this end, we additionally used Buffer RWT (Qiagen) in place of PureLink RNA Mini Kit Wash Buffer I. Finally, RNA was eluted in the Ambion® RNA Storage Solution. The concentration and quality of RNA samples was assessed using a Bioanalyzer RNA kit (Agilent Technologies) to determine the RNA integrity number (RIN).

DeRosa B.A., El Hokayem J., Artimovich E., Garcia-Serje C., Phillips A.W., Van Booven D., Nestor J.E., Wang L., Cuccaro M.L., Vance J.M., Pericak-Vance M.A., Cukier H.N., Nestor M.W, & Dykxhoorn D.M. (2018). Convergent Pathways in Idiopathic Autism Revealed by Time Course Transcriptomic Analysis of Patient-Derived Neurons. Scientific Reports, 8, 8423.

+ Open protocol

+ Expand

Plasma RNA Isolation for Downstream Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

To remove cell debris, 500 µl of plasma was transferred to a 1.5 ml tube and centrifuged (5415 R, Eppendorf) at 1000 g for 5 minutes at 4°C. Next, 200 µl of the supernatant was transferred to a new 1.5 ml tube and mixed with 750 µl lysis mixture containing Qiazol lysis reagent (Qiagen, Maryland, US) with 1.25 µl 0.8 µg/µl MS2 RNA to improve RNA yield and 1 µl Spike-in mix (UniSp2, UniSp4, UniSp5 RNA) (Exiqon, Vedbaek, Denmark) to control for differences in isolation efficiency. Subsequently, 200 µl chloform was added to the samples and followed by vortex for 10 seconds. After 2 minutes incubation at RT the samples were centrifuged at 12,000 g for 15 minutes at 4°C. The upper aqueous phase was then transferred to a 2 ml tube. 1.5 mL 99.9% ethanol (Sigma-Aldrich, St. Louis, US) was added to the samples which followed by 7 seconds of vortex. Samples were transferred to RNeasy mini spin columns (Qiagen, Maryland, US) that were centrifuged at 13,000 g. After washing with RWT buffer and RPE buffer (Qiagen, Maryland, US) the RNA pellet was dried for approximately 1 minute. Lastly, 50 µl water was added to dissolve the RNA. Dissolved RNA was collected in 1.5 ml tubes after centrifugation at 13,000 g. Samples were stored at −80°C.

Nielsen S., Åkerström T., Rinnov A., Yfanti C., Scheele C., Pedersen B.K, & Laye M.J. (2014). The miRNA Plasma Signature in Response to Acute Aerobic Exercise and Endurance Training. PLoS ONE, 9(2), e87308.

+ Open protocol

+ Expand

Ileal Total RNA Extraction and Purification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from host ileal tissues was isolated using an RNeasy Plus Mini Kit (Qiagen) following the supplementary protocol for isolation of total RNA containing microRNA (miRNA), with some modifications. Ileal tissues were thawed at room temperature. Samples were removed from the All Protect Reagent using a sterile forceps and residual reagent was eliminated by rolling the tissue over an optical paper. Approximately 20 mg of ileal tissue was cut and transferred to a sterile 2 mL tube containing RLT Plus buffer and one stainless steel bead (Qiagen). Samples were disrupted and homogenized using a TissueLyzer II for 2 minutes at 30 Hz. After disruption, an optimized two-step DNA removal was applied. In the first step, samples were transferred to a gDNA Eliminator column (Qiagen). After precipitation with 100% ethanol, the eluate was applied to a RNeasy Mini spin column and a second DNA removal step was performed directly on the column membrane using the RNase-Free DNase Set (Qiagen) for 15 minutes at room temperature. DNase I was inactivated with 350 µL RWT buffer (Qiagen). Two washing steps with 500 µL of RPE buffer (Qiagen) were performed and total RNA was eluted with 30 µL of RNase-free water. Total RNA was quantified on NanoDrop One fluorometer (ThermoFisher). RNA integrity was evaluated on an Agilent 2100 Bioanalyzer (Agilent) using the RNA 6000 Nano kit (Agilent).

Leite G., de Freitas Germano J., Morales W., Weitsman S., Barlow G.M., Parodi G., Pimentel M.L., Villanueva-Millan M.J., Sanchez M., Ayyad S., Rezaie A., Mathur R, & Pimentel M. (2023). Cytolethal distending toxin B inoculation leads to distinct gut microtypes and IBS-D-like microRNA-mediated gene expression changes in a rodent model. Gut Microbes, 16(1), 2293170.

+ Open protocol

+ Expand

HEK-293T Cell RNA Extraction

Check if the same lab product or an alternative is used in the 5 most similar protocols

To labeled and unlabeled (controls) HEK-293T cells in 10-cm plates, we added ~1 mL DPBS containing 5 mM Trolox and 10 mM sodium ascorbate, as well as ~4 uL Ribolock RNase inhibitor (Thermo Fischer). The cells were then scrapped off 10-cm plates using cell lifters (Corning), transferred to 2-mL Eppendorf tubes, and spun at ~300G for 4 minutes to pellet cells. The supernatant was removed, and the RNA was extracted from cells using the RNeasy plus mini kit (Qiagen) following the manufacture protocol, including adding ß-mercaptoethanol to the lysis buffer. The cells were sent through the genomic DNA (gDNA) eliminator column supplied with the kit. A modification to the protocol was replacing the RW1 buffer with RWT buffer (Qiagen) for washing. The extracted RNA was eluted into RNase-free water, and RNA integrity was checked using the Agilent bioanalyzer 2100 using the RNA pico assay. Only RNA with a RIN (RNA integrity number) > 8.5 was used for subsequent experiments. RNAs shorter than 100 nt were not efficiently recovered. RNA concentrations were determined using the Nanodrop (Thermo Fischer).

Fazal F.M., Han S., Parker K.R., Kaewsapsak P., Xu J., Boettiger A.N., Chang H.Y, & Ting A.Y. (2019). Atlas of Subcellular RNA Localization Revealed by APEX-seq. Cell, 178(2), 473-490.e26.

+ Open protocol

+ Expand

Transcriptome analysis of Pseudomonas hunanensis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Pseudomonas hunanensis Teo1 was grown in minimal medium with TRIS as only carbon and nitrogen source or with pyruvate and ammonium and cultures were harvested during mid-log phase. Harvested cells were resuspended in 800 μl RLT buffer (RNeasy Mini Kit, Qiagen) with β-mercaptoethanol (10 μl ml⁻¹) and cell lysis was performed using a laboratory ball mill. Subsequently, 400 μl RLT buffer (RNeasy Mini Kit Qiagen) with β-mercaptoethanol (10 μl ml⁻¹) and 1200 μl 96% (vol./vol.) ethanol were added. For RNA isolation, the RNeasy Mini Kit (Qiagen) was used as recommended by the manufacturer, but instead of RW1 buffer, RWT buffer (Qiagen) was used in order to isolate RNAs smaller than 200 nucleotides also. For sequencing, the strand-specific cDNA libraries were constructed with a NEB Next Ultra II Directional RNA library preparation kit for Illumina and the NEB Next Multiplex Oligos for Illumina (New England BioLabs, Frankfurt am Main, Germany). Sequencing was performed by using the HiSeq2500 instrument (Illumina Inc., San Diego, CA, USA) using the HiSeq Rapid SR Cluster Kit v2 for cluster generation and the HiSeq Raid SBS Kit (50 cycles) for sequencing in the single-end mode and running 1 × 50 cycles. Raw reads have been deposited in the Sequence Read Archive (SRR25447477-SRR25447482). More detailed information can be found in the supplementary material.

Holert J., Borker A., Nübel L.L., Daniel R., Poehlein A, & Philipp B. (2024). Bacteria use a catabolic patchwork pathway of apparently recent origin for degradation of the synthetic buffer compound TRIS. The ISME Journal, 18(1), wrad023.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!