Aptima hiv 1 quant dx assay

Manufactured by Hologic

Sourced in United States

The Aptima HIV-1 Quant Dx assay is a laboratory diagnostic tool used to quantify the amount of HIV-1 RNA in human plasma samples. It is designed to provide accurate and reliable measurements of HIV-1 viral load, which is a key indicator of HIV disease progression and treatment response.

Automatically generated - may contain errors

Lab products found in correlation

Powerplex 16 system, by Promega (1 mentions) Cobas taqman analyzer, by Roche (1 mentions) M2000 system, by Abbott (1 mentions) 6800 system, by Roche (1 mentions) Panther system, by Hologic (1 mentions)

4 protocols using aptima hiv 1 quant dx assay

Quantifying HIV-1 in Plasma and Semen

Check if the same lab product or an alternative is used in the 5 most similar protocols

All testing was done at University College Hospitals NHS Trust (London, UK). We used standard clinically validated hospital laboratory assays to measure HIV-1 viral load in plasma and semen samples. Further, we used an in-house ultrasensitive plasma and cerebrospinal fluid (CSF) viral load assay to detect HIV-1 RNA. Seminal plasma was separated from the cellular fraction by centrifugation. We centrifuged 8 mL plasma or CSF at 21 000 g for 2 h at 4°C before removing the supernatant and resuspending the pellet in 700 μL of residual plasma. We then tested the suspension using the Hologic Aptima HIV-1 Quant Dx assay (Marlborough, MA, USA). We measured whole leucocyte and T-cell-specific (CD3-selected) chimerism by short tandem repeat analysis with the PowerPlex16 system (Promega, Madison, WI, USA).

Gupta R.K., Peppa D., Hill A.L., Gálvez C., Salgado M., Pace M., McCoy L.E., Griffith S.A., Thornhill J., Alrubayyi A., Huyveneers L.E., Nastouli E., Grant P., Edwards S.G., Innes A.J., Frater J., Nijhuis M., Wensing A.M., Martinez-Picado J, & Olavarria E. (2020). Evidence for HIV-1 cure after CCR5Δ32/Δ32 allogeneic haemopoietic stem-cell transplantation 30 months post analytical treatment interruption: a case report. The Lancet. HIV, 7(5), e340-e347.

+ Open protocol

+ Expand

Quantification of Plasma HIV-1 RNA and Total HIV-1 DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Plasma HIV-1 RNA was measured by Aptima™ HIV-1 Quant Dx Assay (Hologic, Bedford, MA, USA). The assay uses specific target-capture transcription-mediated amplification (TMA), targets highly conserved regions of HIV-1 polymerase (pol) and long terminal repeat (LTR), and runs on the fully automated Panther platform. It has high sensitivity and a broad dynamic range for HIV-1 detection and quantitation, with a lower limit of quantitation of 30 copies/mL and a 95% limit of detection of 12 copies/mL. Total HIV-1 DNA was quantified by real-time PCR targeting the LTR region in the same nucleic acid extracted from PBMC used for TTV DNA quantification with the sense primer NEC 152 (GCCTCAATAAAGCTTGCCTTGA) and the reverse primer NEC 131 (GGCGCCACTGCTAGAGATTTT) in the presence of a dually (FAM and TAMRA) labeled NEC LTR probe (AAGTAGTGTGTGCCCGTCTGTTRTKTGACT). As a standard curve, dilutions of 8E5 cell DNA containing 1 proviral copy per cell were used [20 (link)]. As for TTV DNA loads in PBMC, total HIV-1 DNA was expressed as log copies/10⁶ cells using the number of cells detected in the sample volume that underwent amplification by the hTERT gene targeted in real time. Also in this case, the in-house real-time PCR used to quantify total HIV-1 DNA had a LOD of 3 copies/reaction volume.

Abbate I., Rozera G., Cimini E., Carletti F., Tartaglia E., Rubino M., Pittalis S., Esvan R., Gagliardini R., Mondi A., Mazzotta V., Camici M., Girardi E., Vaia F., Puro V., Antinori A, & Maggi F. (2023). Kinetics of TTV Loads in Peripheral Blood Mononuclear Cells of Early Treated Acute HIV Infections. Viruses, 15(9), 1931.

+ Open protocol

+ Expand

Prevalence of HBV Viremia in Ghana

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Of the 152 HIV/HBV co-infected patients enrolled in a cross-sectional study of the prevalence of HBV viremia on 3TC-containing ART at the Korle-Bu Teaching Hospital in Ghana^{23 (link)}, 52 on TDF/3TC containing therapy were eligible for the current analysis. Of the eligible patients, two were excluded from the current study; one had received only 9 months of TDF/3TC and we could not verify when the nucleoside backbone was changed from 3TC/didanosine to 3TC/TDF for the other patient. All participants provided written informed consent, including consent to store and use DNA for additional studies. University of Florida Institutional Review Board (IRB) reviewed and approved the current study. The IRBs of the University of Ghana Medical School, Accra, Ghana and Lifespan Hospitals, Providence, Rhode Island approved the initial study. Plasma HBV DNA was determined using COBAS^® TaqMan^® Analyzer (Roche Diagnostics GmbH, Mannheim, Germany). The lower limit of detection of the Roche TaqMan assay^® was 20 IU/mL and the linear range 20 – 170,000,000 IU/mL. Plasma HIV RNA load were determined by using fully automated Aptima HIV-1 Quant dx assay (Hologic, San Diego, CA). The lower limit of detection of the assay was 40 IU/mL with a linear range of 30 to 10,000,000 copies/mL ^{24 (link)}.

Archampong T., Ojewale O., Bears K., Chen Y., Lartey M., Sagoe K.W., Obo-Akwa A., Gong Y., Langaee T, & Kwara A. (2019). Relationship between ABCC4 SNPs and hepatitis B virus suppression during tenofovir-containing antiretroviral therapy in patients with HIV/HBV coinfection. Journal of acquired immune deficiency syndromes (1999), 82(4), 421-425.

+ Open protocol

+ Expand

Comparative Analysis of HIV-1 Quantitative Assays

Check if the same lab product or an alternative is used in the 5 most similar protocols

The Hologic Aptima HIV-1 Quant Dx assay was used on the fully automated Panther system (Hologic, Inc., San Diego, CA). The assay targets the polymerase (pol) and long terminal repeat (LTR) regions. The assay has a minimal required sample volume of 0.7 ml of specimen (0.5 ml plus 0.2 ml of dead volume) and reports quantitative HIV-1 results in a range of 30 to 10,000,000 copies/ml (22 ).
The Roche Cobas HIV-1 assay was performed on the fully automated 6800 system (Roche Molecular Diagnostics, Pleasanton, CA). The assay targets the gag gene and LTR region (dual target). The assay requires at least 0.655 ml of specimen (0.5 ml plus 0.15 ml of dead volume) and reports quantifiable HIV-1 results between 20 and 10,000,000 copies/ml (23 ).
The Abbott RealTime HIV-1 Quant Dx assay was used on the automated m2000 system (Abbott Molecular, Inc., Des Plaines, IL). The assay targets the pol integrase region (single target). The assay is designed to use 0.2, 0.5, 0.6 (used in this study), or 1.0 ml of specimen and reports quantifiable HIV-1 results over the range of 40 to 10,000,000 copies/ml (24 ).

Wiesmann F., Ehret R., Naeth G., Däumer M., Fuhrmann J., Kaiser R., Noah C., Obermeier M., Schalasta G., Tiemann C., Wolf E., Knechten H, & Braun P. (2018). Multicenter Evaluation of Two Next-Generation HIV-1 Quantitation Assays, Aptima Quant Dx and Cobas 6800, in Comparison to the RealTime HIV-1 Reference Assay. Journal of Clinical Microbiology, 56(10), e00292-18.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!