Cardiac stem cell populations were plated on 2-well chamber glass slides (10,000 cells/well) in their respective growth media (see Table 1 ) for a minimum of 24 hours. After incubation, slides were washed with PBS and fixed in 4% paraformaldehyde for 5 minutes at 4°C. Following fixation, the slides were washed twice with PBS and permeabolized in PBS plus 0.1% Triton X-100, 0.1 M Glycine for 3 minutes, then washed once with PBS and blocked with TNB (1X TN (Tris-HCl, NaCl) Buffer, 5 μg/mL blocking reagent (PerkinElmer, #FP1012)) for 30 minutes. Primary antibodies were diluted in TNB (see Online Table I ) and incubated overnight at 4°C. The following day slides were washed twice with PBS. Fluorescently conjugated secondary antibodies were diluted in TNB (1:200) and incubated 1.5 hours at room temperature. For c-Kit staining a horseradish peroxidase (HRP)-linked secondary antibody (1:500) was used, followed by tyramide signal amplification (1:50) (PerkinElmer, #NEL753001KT). After washing twice with PBS, DAPI was included in a final wash to fluorescently label the nuclei, and slides were coverslipped with Vectashield® mounting reagent (Vector Laboratories, #H-1000). All slides were imaged using a Leica TCS SP8 confocal microscope. A table of antibodies and dilution ratios is available in Online Table I .
Nel753001kt
Manufactured by PerkinElmer
Sourced in United States
The NEL753001KT is a laboratory equipment product from PerkinElmer. It is designed to perform a specific function within a laboratory setting. This product description is presented in a factual and unbiased manner, without extrapolation on its intended use.
Automatically generated - may contain errors
Lab products found in correlation
Lsm 700 confocal microscope, by Zeiss (2 mentions)
Fp1012, by PerkinElmer (1 mentions)
Vectashield mounting reagent, by Vector Laboratories (1 mentions)
Tcs sp8 confocal microscope, by Leica (1 mentions)
Alexa fluor conjugates, by Thermo Fisher Scientific (1 mentions)
Prolong gold antifade reagent, by Thermo Fisher Scientific (1 mentions)
Pgem t easy vector kit, by Promega (1 mentions)
Superscript 2 reverse transcriptase first strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Pgem t easy vector, by Promega (1 mentions)
Biotin conjugated secondary antibody, by Thermo Fisher Scientific (1 mentions)
Vectastain elite abc kit, by PerkinElmer (1 mentions)
A1r sted confocal microscope, by Nikon (1 mentions)
14 protocols using nel753001kt
1
Cardiac Stem Cell Immunofluorescence Assay
2
Dual Immunofluorescence Staining of OSCC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Expression of S1PR2 and cytokeratin in primary OSCC tissue samples and non-malignant tonsils was determined by dual immunohistochemistry using OpalTM TSA Plus Cyanine3/ Fluorescein immunofluorescence staining (NEL753001KT, Perkin Elmer). Primary cytokeratin AE1/AE3 antibody (mouse mAb, 1:1000 dilution, Dako) was used with anti-mouse IgG (goat) HRP-conjugated secondary antibody prior to signal amplification with TSA Plus Cyanine 3. The primary-secondary-HRP complex was then removed by microwave treatment. The staining procedure was repeated using primary SIPR2 antibody (rabbit pAb, 1:400 dilution, Sigma), anti-rabbit IgG (goat) HRP-conjugated secondary antibody and TSA Plus Fluorescein for detection. Immunohistochemical staining was semi-quantitatively evaluated using the H-score method. The percentage of tumours corresponding to an ordinal intensity value (0 = none, 1 = weak, 2 = moderate, 3 = strong) was assigned using whole sections. The H-score was defined as the sum of the percentage of tumour cells staining multiplied by the intensity level, resulting in a score ranging from 0 (no staining in any of the cells) to 300 (strong staining in all cells).
3
Atoh1 Expression in Inner Ear Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We performed smFISH as described previously (71 (link)). Briefly, inner ear tissues at P1 were dissected out for cryosection. The slices were treated with 10 μg/mL Proteinase K solution at room temperature for 5 min, followed by 4% PFA to stop the Proteinase K reaction, and then incubated with the digoxigenin-labeled Atoh1 probe; lastly, a tyramide signal amplification kit (catalog NEL753001KT, PerkinElmer) was used to visualize Atoh1 mRNA. After completing the aforementioned procedure, the slices were incubated with anti-Myo7a antibody overnight at 4 °C.
4
Whole-mount Drosophila Embryo Immunostaining and FISH
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Whole-mount Drosophila embryo immunostaining and fluorescent in situ hybridization (FISH) were performed as previously described (Schor et al., 2018 (link)). Fixation of overnight embryo collections was carried out in 4% formaldehyde (from a 16% formaldehyde ultra-pure methanol free stock (Polysciences #18814-10)) for 20 minutes. Immunostaining was performed with the following primary antibodies and dilutions: rat anti-Tropomyosin (1:4000) (Babraham #P6694), mouse anti-Fasciclin III (1:500) (DSHB #7G10), chicken anti-beta-Galactosidase (1:500) (Abcam #ab9361), rabbit anti-Mef2 (1:200) (Furlong lab) and rabbit anti-Biniou (1:200) (Furlong lab). Alexa Fluor conjugates (Thermo Fisher Scientific) were used as secondary antibodies (1:500). Digoxigenin-labeled RNA in situ probes for luna, Nk7.1, and CG14655 were prepared from corresponding EST clones using DIG RNA Labelling Mixture (Roche #11277073910) and the fluorescent detection of mRNA expression was performed using a Tyramide Signal Amplification (TSA) kit (Perkin Elmer #NEL753001KT). Stained embryos were mounted in ProLong Gold Antifade reagent (Thermo Fisher Scientific # P36931) and imaged with a Zeiss LSM780 confocal microscope using a Plan Apochromat 20x/0.8 objective. Images were then visualized in Fiji (Schindelin et al., 2012 (link)).
5
Identification and Localization of Botryllus LOX1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Using homology-based search tools, we identified LOX homologues in the Botryllus Transciptome database from Rodriguez et al. (2014) (link). The contig named CAP3_round1_contig_2680 shared 43% identity to mammalian LOX1 proteins, with an E-value < 1e-39; this sequence has been deposited in the National Center for Biotechnology Information (accession number BankIt1994445 BSeq#1 KY653960). Whole-mount in situ hybridization was performed with digoxigenin-labeled probes as described by Langenbacher et al. (2015) (link). A specific antisense probe for LOX1 was synthesized from PCR products using a LOX1 clone coding for a 368–base pair–specific region of the gene (primer pairs 5′-3′-: forward, GGCGTGTGGAAGTAAAGCAC; reverse, GTGAACCTGGAAACATCGCTT). We used TSA-plus detection (NEL753001KT; PerkinElmer, Waltham, MA) with a fluorescein substrate. Representative images from eight independent experiments consisting of three individual colonies per experiment are shown. Negative controls were conducted using a sense probe from the same sequence and are shown in Supplemental Figure S1.
6
In Situ Hybridization of Neuronal Markers
7
In Situ Hybridization on Cryosections
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ISH was performed on 30‐μm‐thin cryosections as described previously (Sabbagh et al., 2018 (link)). Sections were first allowed to air dry for 1hr at room temperature and washed with PBS for 5 min to remove freezing media. They were then fixed in 4% PFA for 10 min, washed with PBS for 15 min, incubated in proteinase K solution for 10 min, washed with PBS for 5 min, incubated in 4% PFA for 5 min, washed with PBS for 15 min, incubated in acetylation solution for 10 min, washed with PBS for 10 min, incubated in PBS‐diluted 0.1% triton for 30 min, washed with PBS for 40 min, incubated in 0.3% H2O2 for 30 min, washed with PBS for 10 min, pre‐hybridized with hybridization solution for 1 hr, before being hybridized with heat‐denatured riboprobes at 62.5°C overnight. Sections were then washed for five times in 0.2X SSC buffer at 65°C. Slides were then washed with TBS, blocked, and incubated with horseradish peroxidase‐conjugated anti‐DIG (#11207733910, Roche, RRID:AB_514500) or anti‐fluorescein antibodies (#11426346910, Roche, RRID:AB_840257) overnight at 4°C. Lastly, bound riboprobes were detected by a tyramide signal amplification system (#NEL753001KT, PerkinElmer).
8
Dual-probe in situ hybridization for CD133 and VEGFR-2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Whole-mount in situ hybridization was performed with digoxigenin (DIG)-labeled probes as described by [9] (link). Specific antisense probes for both CD133 and VEGFR-2 were synthesized from PCR products using CD133 and VEGFR-2 clones coding for 873 bp and 348 bp regions of the respective genes. TSA-plus detection (PerkinElmer, NEL753001KT) with Cyanine 3 (CD133) and Fluorescein (VEGFR-2) substrates were used in our analysis.
9
In Situ Hybridization for Gene Expression Analysis
10
Whole-mount FISH of Wnt Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Whole-mount FISH was performed with digoxigenin (DIG)-labeled probes as previously described [44 ]. Specific sense and antisense probes for wnt2B, wnt5A, and wnt9A were synthesized from PCR products using the relative clones coding for 844 bp, 722 bp, and 887 bp regions of the respective genes. Primers used to synthesize probes were 5′-gttgtgtgcgtcacctgttc-3′ and 5′-tttgggtccgttttgggtga-3′ for wnt2B; 5′-tcgctagcatcgcctcgtgc-3′ and 5′-aaagtgcgcaggccctcgag-3′ for wnt5A; 5′-cgagagatggaactgcacga-3′ and 5′-aagggagactgtgcgacaag-3′ for wnt9A. TSA-plus detection (NEL753001KT PerkinElmer, Waltham, MA, USA) with cyanine 3 and fluorescein substrates was used in our analysis.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!