The largest database of trusted experimental protocols

Sk n sh

Manufactured by Korean Cell Line Bank
Sourced in United States, Cameroon

SK-N-SH is a human neuroblastoma cell line. It is derived from a bone marrow biopsy of a 4-year-old female patient with neuroblastoma. The SK-N-SH cell line is commonly used for research in neuroscience and cancer biology.

Automatically generated - may contain errors

7 protocols using sk n sh

1

Parkin Function in Neurodegenerative Diseases

Check if the same lab product or an alternative is used in the 5 most similar protocols
SK-SH5Y, SK-N-SH, and N2A cells were obtained from the Korean Cell Line Bank (KCLB, Seoul, Korea). Cells were grown in RPMI-1640, and supplemented with 10% fetal bovine serum (FBS) and 1% penicillin–streptomycin (HyClone, PA, USA). The transient transfection of myc-tagged or GFP-tagged parkin, AIMP2, DX2, HA-tagged ubiquitin, and empty vector was performed using lipofectamine 2000 (Invitrogen, CA, USA). Propidium iodide solution (PI), 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetra-zolium bromide (MTT), rotenone, and 6-OHDA were obtained from Sigma-Aldrich (St. MO, USA). siRNA targeting DX2 (CACGUGCAGGAUUACGGGGC) was purchased from Bioneer (Seoul, Korea).
+ Open protocol
+ Expand
2

Cell Culture Protocol for Human Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
SK-N-SH was purchased from the Korean Cell Line Bank (Seoul, Korea) and other cell lines (SK-N-BE(2), SH-SY5Y, BJ, CCD-1079SK, HUVEC) were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). Cells were cultured in DMEM supplemented with 10% FBS and penicillin/streptomycin at 37 °C and 5% CO2.
+ Open protocol
+ Expand
3

Neuroblastoma Cell Culture Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols
SK-N-BE(2)-M17 (male), SH-SY5Y (female), and Neuro-2A mouse neuroblastoma cells were purchased from American Type Culture Collection (Manassas, VA, USA), and IMR-32 (male), SK-N-SH (female) and SK-N-MC (female) human neuroblastoma cells were obtained from Korean Cell Line Bank (Seoul, Korea). All cells except IMR-32 were cultured in DMEM supplemented with L-glutamine (300 mg/ml), 25 mM HEPES, 25 mM NaHCO3, 10% heat-inactivated FBS and antibiotic-antimycotic agents at 37 °C in a 5% CO2 incubator. IMR-32 cells were grown in RPMI media supplemented with L-glutamine (300 mg/ml), 25 mM HEPES, 25 mM NaHCO3, 10% heat-inactivated FBS and antibiotic-antimycotic agents. Before treatment with CFZ, Cis, or other drugs, cells were refreshed with the culture media and stabilized for 3 h.
+ Open protocol
+ Expand
4

Culturing Human Neuroblastoma and Fibroblast Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human neuroblastoma cells (SK-N-SH) were purchased from the Korean Cell Line Bank (Seoul, Korea). Non-tumorigenic fibroblast HS 68 (CRL-1635) cells were purchased from the American Type Culture Collection (Manassas, Virginia, USA). Cells were cultured in suitable media (SK-N-SH; RPMI-1640 media, HS 68; DMEM media) with 10% of fetal bovine serum, 100 U/mL penicillin, and 100 U/mL streptomycin at 37 °C in a humidified 5% CO2 atmosphere. The cell passage for SK-N-SH and HS 68 subculture were within passage number 3–7.
+ Open protocol
+ Expand
5

Neuronal Cell Death Screening Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Hela, Hek293T, SK-N-SH, SK-SH5Y, and THP-1 were obtained from the Korean Cell Line Bank (KCLB, Seoul, South Korea). Cells were grown in RPMI-1640, and supplemented with 10% fetal bovine serum (FBS) and 1% penicillin–streptomycin (HyClone, PA, USA). Rotenone was obtained from Sigma-Aldrich (MO, USA). 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) Hydrochloride was purchased from TCI chemicals (M2690, Tokyo, Japan) and dissolved in saline (0.9% NaCl, 3.75 mg/ml aliquots prepared fresh before injection). The chemicals used for neuronal cell death screening were: TNF-α (210-TA, Sigma-Aldrich, MO, USA), cycloheximide (66-81-9, MO, USA), actinomycin D (11805017, Thermo Fisher, MA, USA), cisplatin (D3371, TCI Chemical, Tokyo, Japan), paclitaxel (P1632, TCI Chemical, Tokyo, Japan), 5-fluorouracil (F0151, TCI Chemical, Tokyo, Japan), 6-hydroxydopamine hydrochloride (H4381, Sigma-Aldrich, MO, USA). The primary antibodies used were α-tubulin (sc-5286, Santa Cruz, TX, USA), Bax (2772 s, CST, MA, USA), tyrosine hydroxylase (ab6211, abcam, Cambridge, England), cleaved caspase-8 (9496 s, CST, MA, USA), cleaved caspase-9 (7237 s, CST, MA, USA), and p53 (sc-53394, Santa Cruz, TX, USA).
+ Open protocol
+ Expand
6

Culturing SKN-SH Neuroblastoma Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
We purchased the human neuroblastoma cell line, SKN-SH, from the Korean Cell Line Bank (Seoul, Korea). Cells were maintained in Roswell Park Memorial Institute-1640 (RPMI-1640) medium (HyClone, Logan, UT, USA) supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin antibiotic (Life Technologies, Paisley, UK). They were expanded in a humidified CO2 incubator (5%) at 37°C in T-75 flasks after trypsinization and subsequent washing in phosphate-buffered saline.
+ Open protocol
+ Expand
7

Cell Culture and Transfection Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human embryonic kidney (HEK293) (KCLB: 21,573), SH-SY5Y (KCLB: 22,266), and SK-N-SH (KCLB: 30,011) cells were purchased from the Korean Cell Line Bank (Seoul, South Korea). SK-N-DZ and SK-N-AS were kindly provided by Prof. Sung-Oh Huh from Hallym University, South Korea. SK-N-DZ, SK-N-AS and HEK293 cells were maintained in Dulbecco’s Modified Eagle Medium (DMEM) (PAN BIOTECH, P04-03590, Aidenbach, Germany) supplemented with 10% fetal bovine serum (FBS) (Gibco BRL, Cat. No. 10,082,147, Rockville, MD, USA) and 1% penicillin and streptomycin (Gibco BRL, Cat. No. 15,140,122, Rockville, MD, USA), while the SH-SY5Y and SK-N-SH cells were maintained in a 1:1 mixture of minimum essential medium (MEM): F12 medium supplemented with 10% FBS and 1% penicillin and streptomycin at 37 °C in a humidified atmosphere with 5% CO2.
The transfection of plasmids and shRNA in the HEK293 cell line was performed using polyethylenimine (Polysciences, Cat. no. 25449-100, Warrington, USA). The SK-N-DZ, SK-N-AS, SH-SY5Y, and SK-N-SH cells were transfected with Lipofectamine 3000 (Thermo Fisher Scientific Cat. no. L3000001, USA) according to the manufacturer’s protocol.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!