Asp6025 processor

Intestinal tissues with luminal contents were carefully excised and fixed in freshly made nonaqueous Methacarn solution (60% methanol, 30% chloroform and 10% glacial acetic acid) as previously described for 6 h at 4 °C. Tissues were washed in 70% ethanol, processed with Leica ASP6025 processor (Leica Microsystems) and paraffin-embedded by standard techniques. Subsequently, 5-μm sections were baked at 56 °C for 1 h before staining. Tissue sections were deparaffinized with xylene (twice, 10 min each) and rehydrated through an ethanol gradient (95%, 10 min; 90%, 10 min) to water. Sections were incubated at 50 °C for 3 h with custom probes specific to:
BS: [Alexa488]- TACCGAAGTTCTTTAATCACGAGA -[Alexa488])
BP: [Alexa546]- TATAAGACTCAATCCGAAGAGATCAT -[Alexa546]
CB: [Alexa594]- GATTTGCTCCACATCACTGTC -[Alexa594]
PD: [Alexa647]- CAGCGATGAATCTTTAGCAAATATCC -[Alexa647]
Probes were diluted to 5 ng μl−1 in 0.9 M NaCl, 20 mM Tris-HCl at pH 7.2 and 0.1% SDS before use. Sections were later washed twice in 0.9 M NaCl, 20 mM Tris-HCl at pH 7.2 (wash buffer) for 10 min and counterstained with Hoechst (1:3,000 in wash buffer) for nuclear staining.
Image acquisition was performed with a Leica TCS SP5-II upright confocal microscope using a 63x oil immersion lens. Fiji (ImageJ) software was used to modify colors.