Tmc353121

DMEM (catalogue no. 41965-039), PBS (catalogue no. 14190-094) and non-essential amino acid solution (NEAA; catalogue no. 11140-035) were obtained from Thermo Fisher Scientific. FBS was obtained from Hyclone (catalogue no. SV30160.03) and heat inactivated at 56°C for 30 min. HEp-2 cells and RSV-A Long strain were obtained from ATCC (catalogue no. CCL-23 and VR-26, respectively). HuAECs of bronchial origin in an air–liquid interface cell culture system and MucilAir medium were obtained from Epithelix (catalogue no. EP01MD and EP04MM, respectively), a Swiss company that has developed a technology that allows epithelium to reach a homeostatic state with a slow turnover. It is a ready-to-use product and commercially available (http://www.epithelix.com/). ALS-8112 and ALS-8176,¹¹ (link) AZ-27¹⁴ (link) and PC786¹⁵ were synthesized according to published procedures (purity >98%). GS-5806 and TMC353121 were obtained from MedChemExpress (NJ, USA) and ribavirin was from ICN Pharmaceuticals (CA, USA).

A 35 bases long fully phosphorothioate-modified oligonucleotide, designated ssON, with sequence: 5’-GAAGTTTTGAGGTTTTGAAGTTGTTGGTGGTGGTG-3’, was purchased from Integrated DNA Technologies. The 2′OMe PS with sequence GAAGUUUUGAGGUUUUGAAGUUGUUGGUGGUGGUG was also purchased from Integrated DNA Technologies. The 30-mer (5′-AGTTTTGAGG TTTTGAAGTTGTTGGTGGTG-3′), the 25-mer: 5′-TTTGAGGTTTTGAAGTTGTTGGTGG-3′, the 20-mer: 5′-TGAGGTTTTGAAGTTATTGG-3′ and the 15-mer: 5′- GGTTTTGAAGTTGTT-3′, were all purchased from Eurofins. RSV fusion inhibitors TMC353121 and Presatovir (GS-5806) were purchased from MedChemExpress. The nucleolin inhibitor AS1411 and a negative control (CRO) were kindly provided by Professor Richard G. Hegele, University of Toronto.

HEp-2 and HEK293T cells were purchased from the American Type Culture Collection (ATCC) and maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 2 mM l-glutamine. RSV A2 was obtained from Wuhan University, China. RSV A2-F_K394R was isolated and identified in our previous study (29 (link)). All the viruses were grown in HEp-2 cells and stored at −70°C. Viral titers were determined by plaque assay. Salvianolic acid R (LF-6) was isolated from the aerial part of Mesona chinensis Benth. (Lamiaceae) by the authors, following our previously reported procedure (30 (link)). The purity of LF-6 (>98%) was validated through high-performance liquid chromatography (HPLC) analysis. Ribavirin, heparin, and BMS-433771 were purchased from Sigma-Aldrich, Inc. TMC-353121, JNJ-53718678, GS-5806, and AK-0529 were purchased from MedChem Express, Inc.