The cell lines 786-O and A-498 were obtained from American Type Culture Collection (ATCC, Manassas, VA, USA). 786-O cells and A-498 cells were respectively cultured in PRMI 1640 (Gibco by Life Technologies, Grand Island, NY, USA) and MEM Alpha medium (Gibco by Life Technologies, Grand Island, NY, USA) containing 10% fetal bovine serum (FBS, BI, Kibbutz Beit Haemek, Israel) and 100 U/mL penicillin and 0.1 mg/mL streptomycin (BBI life sciences, shanghai, China) at 37 °C in a humidified incubator with 5% CO2. The sequence of shRNA targeting MCM7 was cloned into pLVX vector. The transfection was performed using lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’ s guidelines.
Streptomycin
Manufactured by BBI Lifesciences
Sourced in China
Streptomycin is a broad-spectrum antibiotic used in laboratory settings. It is a type of aminoglycoside antibiotic produced by the bacterium Streptomyces griseus. Streptomycin acts by inhibiting protein synthesis in bacterial cells, effectively killing or preventing the growth of various bacterial species.
Automatically generated - may contain errors
Lab products found in correlation
Penicillin, by BBI Lifesciences (6 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (4 mentions)
Mem alpha medium, by Thermo Fisher Scientific (2 mentions)
Prmi 1640, by Thermo Fisher Scientific (2 mentions)
Human stem cell factor, by R&D Systems (2 mentions)
Human il 6, by R&D Systems (2 mentions)
Lymphoprep reagent, by STEMCELL (2 mentions)
Human il 3, by R&D Systems (2 mentions)
Carbenicillin, by BBI Lifesciences (1 mentions)
Tetracycline, by BBI Lifesciences (1 mentions)
Gentamicin, by BBI Lifesciences (1 mentions)
Ampicillin, by BBI Lifesciences (1 mentions)
Cycloheximide (chx), by Merck Group (1 mentions)
Mg132, by Merck Group (1 mentions)
Chloroquine, by Merck Group (1 mentions)
Eagle s minimum essential medium, by Sartorius (1 mentions)
Tc dapk6, by MedChemExpress (1 mentions)
Penicillin streptomycin, by BBI Lifesciences (1 mentions)
Stemspan sfem medium, by STEMCELL (1 mentions)
Penicillin, by Sangon (1 mentions)
9 protocols using streptomycin
1
MCM7 Knockdown in Renal Cancer Cells
2
Isolation and Culture of Ph+ B-ALL Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Heparinized bone marrow samples were collected from 6 patients with newly diagnosed Ph+ B-ALL (detailed information for these patients are provided in Supplementary Table S2 ). Mononuclear cells (MNCs) were then separated by density gradient centrifugation using Lymphoprep reagent (Stemcell Technologies). Subsequently, MNCs were cultured in StemSpan basic media (Stemcell Technologies) supplemented with 10 ng/mL human stem cell factor, 10 ng/mL human IL-3, 10 ng/mL human IL-6 (all above cytokines were purchased from R&D Systems), 100 U/mL penicillin, and 100 μg/mL streptomycin (both from BBI Life Sciences). This study was approved by the Institutional Review Board of the Ruijin Hospital affiliated to Shanghai Jiao Tong University School of Medicine. Informed consent for the in vitro drug testing studies was obtained in accordance with the Declaration of Ruijin Hospital affiliated to Shanghai Jiao Tong University School of Medicine.
3
Bacterial Culture and Genetic Manipulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The bacterial strains used in this study are listed in Table S2 . Bacteria were cultured in Luria–Bertani (LB) broth (10 g/l tryptone, 5 g/l Nacl, 5 g/l yeast extract, pH 7.0–7.5) or LB agar (LB broth containing 15 g/l agar) under aerobic conditions at 37°C. When needed, the medium was supplemented with tetracycline (100 μg/ml) (BBI life sciences, Shanghai, China), gentamicin (100 μg/ml) (BBI life sciences), streptomycin (50 μg/ml) (BBI life sciences), or carbenicillin (150 μg/ml) (BBI life sciences) for P. aeruginosa, and ampicillin (100 μg/ml) (BBI life sciences) for E. coli.
Plasmids used in this study are listed in TableS2 . For DNA manipulation, standard protocols or manufacture instructions of commercial products were followed. Chromosomal gene mutations were generated as described previously (Hoang et al., 1998 (link)).
Plasmids used in this study are listed in Table
4
Silencing DAPK1 in MGC-803 cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MGC-803 cells were grown in PRMI-1640 medium (Biological Industries, Kibbutz Beit, Haemek, Israel) with 100 U/mL penicillin and 0.1 mg/mL streptomycin (BBI Life Sciences, Shanghai, China) and 10% FBS (BI, Kibbutz Beit, Haemek, Israel) at 37 °C with 5% CO2. The shRNA sequence of DAPK1 was cloned into the pLVX vector. The target sequence of DAPK1-specific shRNA was as follows: 5′-CAAGAAACGTTAGCAAATG-3′. Transfection was performed with lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA).
5
Hep3B and PLC/PRF/5 Cell Culture Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Hep3B and PLC/PRF/5 cells were cultured in Eagle’s minimum essential medium (Biological Industries [BI]), and HEK‐293T cells were cultured in DMEM (BI) supplemented with 10% FBS (BI), 100 U/mL penicillin, and 100 μg/mL streptomycin (1% penicillin/streptomycin) (BBI Life Sciences) at 37°C in a humidified atmosphere containing 5% CO2. Transient transfection was carried out using VitalGENE‐II In Vitro DNA Transfection Kit (Biocanaan) according to the manufacturer’s instructions. Cells were treated with CHX at 10 μg/mL (Sigma‐Aldrich) for 4 hours, chloroquine at 1 μg/mL (Sigma‐Aldrich) for 24 hours, and MG132 at 1 μg/mL (Sigma‐Aldrich) for 6 hours. The DAPK kinase activity inhibitor TC‐DAPK6 (MedChem Express) was used at 100 nmol/L for 24 hours. RGD (MedChem Express) was used at 100 μmol/L for 24 hours.
6
Isolation and Culture of AML Mononuclear Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bone marrow (BM) samples were collected from patients with AML (patient details are provided in Supplementary Table S1). Mononuclear cells were separated with Lymphoprep reagent (Stemcell Technologies) using density gradient centrifugation. They were subsequently cultured in StemSpan SFEM medium (Stemcell Technologies) supplemented with 10 ng/mL human stem cell factor, 10 ng/mL human IL3, 10 ng/mL human IL6 (all cytokines were purchased from R&D Systems), 100 U/mL penicillin, and 100 μg/mL streptomycin (both from BBI Life Sciences).
Written informed consents were obtained from all patients in accordance with the Declaration of Helsinki, and all manipulations were approved by the Institutional Review Board of Guangzhou First People's Hospital, School of Medicine, South China University of Technology (Guangzhou, P.R. China).
Written informed consents were obtained from all patients in accordance with the Declaration of Helsinki, and all manipulations were approved by the Institutional Review Board of Guangzhou First People's Hospital, School of Medicine, South China University of Technology (Guangzhou, P.R. China).
7
Cell Culture Conditions for HEK293, iSLK, and HUVEC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293, HEK293T, iSLK (1 μg/ml puromycin and 250 μg/ml G418) (a gift from Shou-Jiang Gao at the University of Southern California), and iSLK.219 (1.1 mg/ml hygromycin, 250 μg/ml G418, and 1 μg/ml puromycin) (25 (link)) cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 1% penicillin (Sangon Biotech Inc., Shanghai, People’s Republic of China), and streptomycin (BBI Life Sciences, Shanghai, People’s Republic of China). HUVECs, BJAB cells, and BCBL1 cells were cultured with RPMI 1640 medium containing 10% FBS. All cell lines were incubated at 37°C in a humidified environmental incubator with 5% CO2. For hypoxia treatment, cell lines were incubated at 37°C in a humidified environmental incubator with 5% CO2 and 0.2% O2 in a BioSpherix hypoxic culture system.
8
Knockdown of LARS in Saos-2 and U-2 OS cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cell lines Saos-2 and U-2 OS were obtained from ATCC (American Type Culture Collection). Saos-2 and U-2 OS cells were cultured in DMEM medium (Gibco) containing 10% fetal bovine serum (FBS, BI, Kibbutz Beit Haemek, Israel), 100 U/mL penicillin and 0.1 mg/mL streptomycin (BBI life sciences, shanghai, China) andat 37 °C in a humidified incubator with 5% CO2. The sequence of shRNAs targeting LARS was cloned into pLVX vector. The sequence of LARS shRNA1 was 5′-CTGGACATCACTTGTTTCT-3′; The sequence of LARS shRNA2 was 5′-AAATGAAGGCGTCCATTCA-3′. The transfection was performed using lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’ s guidelines.
9
Silencing UBE2I in Renal Cancer Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ccRCC A-498 cells and 786-O were obtained from ATCC (American Type Culture Collection, Manassas, VA, USA). A-498 cells and 786-O cells were, respectively, cultured in MEM Alpha medium (Gibco by Life Technologies, Grand Island, NY, USA) and PRMI 1640 (Gibco by Life Technologies) containing 10% fetal bovine serum (BI, Kibbutz Beit Haemek, Israel) and 0.1 mg/mL streptomycin (BBI Life Sciences, Shanghai, China) and 100 U/mL penicillin at 37°C in a humidified incubator with 5% CO2. The sequence of shRNA targeting UBE2I was cloned into a pLVX vector. The shRNA sequences were as follows: 5′-CCGG GAACTTCTAAATGAACCAAATCTCGAGATTTGGTTCATTTAGAAGTTCTTTTTG-3′. The transfection was performed using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s guidelines.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!