The largest database of trusted experimental protocols

5 protocols using beyort 3 cdna synthesis kit

1

Quantification of PGC-1α and NRF-1 in OSA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Tissues were cut and homogenized, and RNA was extracted. The concentration and purity of the RNA and synthesized cDNA were determined according to the instructions of the Beyort™III cDNA Synthesis Kit (BeyoTime) (The primer sequences were shown in Table 1). With cDNA as the template and GAPDH as internal reference, the relative mRNA expression levels of PGC‐1α and NRF‐1 in the palatopharyngeus muscle of the OSA and control groups were assessed according to the instructions of the qPCR kit (Beyotime).
+ Open protocol
+ Expand
2

RT-PCR Analysis of C. lactatifermentans

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA from C. lactatifermentans cells grown in glucose medium was used to conduct RT-PCR for cotranscriptional analysis. cDNA was synthesized with genomic DNA-free RNA (1 μg) according to the manufacturer’s instruction of the BeyoRT III cDNA synthesis kit (Beyotime, Shanghai, China). The genomic DNA of C. lactatifermentans was used as the positive control and RNA (gDNA-free) was used as the negative control. Primers used for RT-PCR are listed in Table S3.
+ Open protocol
+ Expand
3

Quantifying CCL18 Expression in Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
The relative expression of CCL18 mRNA in Um95, M23, M17 and SP6.5 cells was detected by realtime PCR. Whole cell RNA was extracted by Trizol (15,596,018, Life Technologies, USA) method and then RNA transcribed into cDNA using a BeyoRT™ III cDNA Synthesis Kit (Beyotime Biotechnology, Shanghai, China). BeyoFast™ SYBR Green qPCR Mix (2X) (D7260, Beyotime Biotechnology, Shanghai, China) kit were used to performed Real-time PCR assay. The qPCR experimental results were calculated by 2−△△CT method. Primer sequences were shown in Table 1.

Primer sequences for qPCR

GenePrimer sequences
CCL18F: GTTGACTATTCTGAAACCAGCCC
R: GTCGCTGATGTATTTCTGGACCC
CXCL8F: GAGAGTGATTGAGAGTGGACCAC
R: CACAACCCTCTGCACCCAGTTT
GTPBP1F: CCTTCATCGACTTGGCTGGTCA
R: CCAGGTGTTCTTTGGTCATCCC
JAG2F: GCTGCTACGACCTGGTCAATGA
R: AGGTGTAGGCATCGCACTGGAA
PRELID1F: GGAGGACTCTATTGTGGACCCA
R: CAGTCCAGCCACTGTTGTCAGA
PTGER4F: TACTCATTGCCACCTCCCTGGT
R: GACTTCTCGCTCCAAACTTGGC
GAPDHF: GTCTCCTCTGACTTCAACAGCG
R: ACCACCCTGTTGCTGTAGCCAA
+ Open protocol
+ Expand
4

Quantifying mRNA Expression by qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA in cells was extracted by Trizol (KGA1202, KeyGEN Biotech, China), and then the synthesis of cDNA was operated through reverse transcription by the BeyoRT III cDNA Synthesis Kit (D7178, Beyotime, China). Next, cDNA and primers for detecting mRNA, as well as SYBR Green Supermix (A46113, Applied Biosystems, USA) for labeling, were added to a Fast7500 real-time PCR system (ABI, USA) to conduct the qPCR, and the thermal cycling program included predenaturation at 95°C for 2 min, 40 cycles of 95°C for 5 s and 60°C for 30 s. Following these, the internal reference gene GAPDH was utilized to calculate the mRNA level of the genes listed in Table 1 according to the 2−ΔΔCt formula [24 (link)].
+ Open protocol
+ Expand
5

Mogroside V Bioactivity and Mechanism

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mogroside V (MV, HPLC > 98%, Figure S1) was obtained from Nanjing Plant Origin Biological Technology Co., Ltd. (Nanjing, China; CAS:88901-36-4). Dorsomorphin (Compound C) was supplied by MedChemExpress (purity: 99.65%, Jersey, USA; CAS: 866405-64-3). Palmitic acid, oleic acid, and 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT) were provided by Sigma (St. Louis, MO, USA). Triglyceride (TG), nonesterified fatty acid (NEFA), total cholesterol (T-CHO), aspartate aminotransferase (AST), and alanine transaminase (ALT) assay kits were obtained from Jiancheng Bioengineering Institute (Nanjing, China). Insulin ELISA kit was from Shanghai Hengyuan Biological Technology Co., Ltd (Shanghai, China). AMPK and p-AMPK (phospho-Thr172) antibodies were purchased from Santa Cruz (Dallas, USA); PPAR-γ, PPAR-α, FASN, CPT-1A, and α-tubulin antibodies were supplied by Proteintech (Chicago, USA); SREBP-1 antibody was purchased from Novus Biologicals (Littleton, Colorado, USA). TRIzol reagent was purchased from Invitrogen (Carlsbad, USA); BeyoRT™ III cDNA Synthesis Kit and BeyoFast™ SYBR Green qPCR Mix were purchased from Beyotime Institute of Biotechnology (Jiangsu, China).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!