Celltram vario

C57BL/6J female mice were superovulated and oocytes were in vitro fertilised with C57BL/6J sperm. Fertilised eggs were cryopreserved by vitrification^{39 (link)} at the pronuclear stage. One hour after thawing, morphologically normal zygotes were cultured in KSOM medium (ARK Resource) and microinjected. For the generation of EGFP transgenic mice, pCriMGET-pCAG-EGFP-pA (25 ng/µL), syn-crRNA-TS-crRNA (50 ng/µL), tracrRNA (100 ng/µL) and Cas9 protein (100 ng/µL) were microinjected into the pronuclei of zygotes. For the generation of Tbx3-flag-EGFP knock-in mice, pCriMGET-3×Flag-P2A-EGFP (25 ng/µL), Tbx3-crRNA (50 ng/µL), syn-crRNA-TS-crRNA (10 ng/µL), tracrRNA (100 ng/µL) and Cas9 protein (100 ng/µL) were microinjected into the pronuclei of zygotes. For the generation of Clec4f-IRES-hDTR-P2A-EGFP knock-in mice, pCriMGET-IRES-hDTR-P2A-EGFP (25 ng/µL), Clec4f-crRNA (50 ng/µL), syn-crRNA-TS-crRNA (10 ng/µL), tracrRNA (100 ng/µL) and Cas9 protein (100 ng/µL) were microinjected into the pronuclei of zygotes. The microinjection was performed using a Leica Micromanipulator and Eppendorf CellTram Vario. The injected zygotes were cultivated in KSOM medium overnight and then transferred into the oviducts of pseudopregnant ICR mice.

A NR3C1 specific MAO was designed to bind the 5′UTR upstream of the translation initiation site in the rhesus macaque NR3C1 gene (XM_015141112.1: TGGAGTCCATCAGTGAATATCAACT), thereby inhibiting its translation. A MAO recognizing a splice site mutant of the human hemoglobin beta-chain (HBB) gene (AY605051: CCTCTTACCTCAGTTACAATTTATA) was used as a standard (STD) control. Both the NR3C1 and STD MAOs were synthesized with a 3′-carboxyfluorescein tag to aid in visualization during embryo microinjection. Oocytes were collected at 6 h or 36 h following hCG injection to rhesus macaque females undergoing a COS protocol. The MAOs were reconstituted in embryo grade water (Sigma- Aldrich, W1503) and microinjected using a CellTram vario, electronic microinjector and Transferman NK 2 Micromanipulators (Eppendorf, Hauppauge, New York, USA). The MAO concentration (0.3 mM) was chosen based on previous reports that this concentration of STD MAO did not impact blastocyst formation rates in both mice^{41 (link)} and rhesus macaques^{42 (link)}.

EPC surfaces were functionalized with fibronectin (FN) (20 µg/mL in PBS). For precise seeding of cells into the pillar rings, borosilicate microcapillaries (outside diameter: 1.0 mm, inside diameter: 0.72 mm, Hilgenberg, Malsfeld, Germany) were used. The front end of the capillary was forged to an outer diameter of 15 µm using a capillary puller (Sutter Instrument, Novato, CA, USA) and bent to an angle of 45° using a homemade microforge. Cells were detached from cell culture flasks with trypsin/EDTA (0.05%), resuspended in growth media, and loaded into the capillary (5 × 10⁵ cells/mL). Cell injection was performed by using a micromanipulator (Inject Man) and an oil-driven microinjector (CellTram vario) (both Eppendorf, Wesseling, Germany).

The DNA injection solution was centrifuged at 14,000 rpm for 30 min at 4°C and a 5-µl aliquot was loaded into the tip of a Femtotip II microinjection needle (no. 5242 957000, Eppendorf) using a microloader (no. 5242 956003, Eppendorf). After 30 min at room temperature, the needle was filled with sterile mineral oil (M8410, Sigma) using the microloader and tightly mounted in the capillary holder of a microinjector CellTram vario (no. 5176 000033, Eppendorf), and then fixed onto the micromanipulator.

In order to target cells to the future tailbud, cells from fluorescent dextran labeled (either Rhodamine, Fluorescein, or Cascade Blue dextran, MW 10,000, Molecular Probes) sphere stage donor embryos were transplanted into the ventral margin of unlabeled shield stage host embryos, as previously described (Martin and Kimelman, 2012 (link)). Transplantations were performed under a Leica S6E dissecting microscope using a Cell Tram Vario (Eppendorf). Statistical analysis of quantified cell transplants was performed with the Fisher’s exact test.

Single (for immunofluorescence confocal microscopy) or double (for qRT-PCR) blastomere microinjections of 2-cell (E1.5)-stage embryos were performed using a FemtoJet or FemtoJet 4i (Eppendorf, Hamburg, Germany; Cat. No. 5252000013) microinjector, a mechanical micromanipulator (Leica, Wetzlar, Germany; Cat. No. ST0036714) and a CellTram Vario (Eppendorf; Cat. No. 5176000033) pneumatic handler under a negative capacitance-enabled current controlled by an Electro 705 Electrometer (WPI, Sarasota, Florida, USA; Cat. No. SYS-705) and on the stage of an Olympus IX71 inverted fluorescence microscope. The embryos were pneumatically handled and immobilized for microinjection using a borosilicate glass capillary holder (without filament—Harvard Apparatus, Holliston, Massachusetts, USA; Cat. No. 30-0017). Injection needles prepared from filamented borosilicate glass capillaries (Harvard Apparatus; Cat. No. 30-0038) using a Narishige PC-10 capillary glass needle puller (Narishige Scientific Instrument Lab., Tokyo, Japan) were connected to the microinjector. All siRNAs (Supplementary Table 4) were co-microinjected at 10 µM concentrations with 50 ng/µl H2b-RFP mRNA in prewarmed drops of M2 medium overlaid with mineral oil on the surfaces of concave microscope slides.