Probeon plus microscope slides

RNA in situ hybridization was performed as previously described, with minor modifications [32 (link)]. Briefly, the plant materials were fixed in FAA fixative for 8 h at 4°C after vacuum infiltration and dehydrated using a graded ethanol series, followed by a xylene series, and embedded in Paraplast Plus (Sigma-Aldrich). Microtome sections (9 μm) were mounted on Probe-On Plus microscope slides (Fisher). The 141-bp regions of OsFIP was amplified using the primers 5’- GGAAGAAAGTGCGCCAGGTG -3’ and 5’- GATTTGGCAGCCTCCCGTTC -3’ and then subcloned into the pEASY-T3 (TransGen Biotech) vector and used as the template to generate sense and antisense RNA probes. The OsMTA2 probe was amplified using the primers 5’- AGGTGGTTCCCAGCTGAAGG -3’ and 5’- GCAGGTCTTTGTGTGACGGC -3’. The antisense probe was transcribed using T7 RNA polymerase, and the sense probe was synthesized using SP6 RNA polymerase. Digoxigenin-labeled RNA probes were prepared using a DIG RNA Labeling Kit (SP6/T7) (Roche) according to the manufacturer's instructions. Photomicrographs were obtained using a bright-field microscope (Leica DM5000B).

We stably transfected MDA-MB-231 cells with expression vectors encoding shRNAs targeting P2Y₂R (MDA-MB-231-P2Y₂R-shRNA) or with an empty vector (MDA-MB-231-EV). Athymic nude mice were divided into two groups and injected subcutaneously with empty vector-transfected MDA-MB-231 (MDA-MB-231-EV; n = 10) or P2Y₂R-shRNA-transfected MDA-MB-231 (MDA-MB-231-P2Y₂R-shRNA; n = 10) (5 × 10⁶ cells/100 μl of serum-free medium). The experimental protocol was approved by the Institutional Animal Care and Use Committee at Gyeongsang National University (approval number: GLA-120208-M004). Body weights and tumor volumes were measured every 3 days, starting at 7 days after injection. At the end of 60 days, the mice were sacrificed. Lung tissue or tumor mass was fixed in 4% paraformaldehyde at room temperature, followed by paraffin infiltration and embedding. Sections of 5 μm were mounted onto ProbeOn Plus microscope slides (Fisher Scientific, Loughborough, UK) and stained with H&E. Immunohistochemical analysis was performed using anti-vimentin, -VCAM-1, -VEGF, -ICAM-1 and CD31 antibodies for lung staining, and H&E and anti-P2Y₂R antibody (Abcam) for tumor staining, and the staining was examined under a light microscope.

In situ RNA hybridization was performed as described previously, with minor modifications [81 (link)]. Briefly, plant materials were fixed in FAA fixative for 8 h at 4°C, then dehydrated after vacuum infiltration using a graded ethanol series followed by a xylene series and embedded in Paraplast Plus (Sigma-Aldrich,St. Louis, MO, USA). Microtome sections (8 μm) were mounted on Probe-On™ Plus microscope slides (Fisher, Waltham, MA, USA), and lncRNAs were amplified, subcloned into the pEASY™-T3 (TransGen Biotech, Beijing, PR China) vector and used as templates to generate sense or antisense RNA probes. The probes were transcribed using T7/SP6 RNA polymerase. Digoxigenin-labeled RNA probes were prepared using the DIG RNA Labeling Kit (SP6/T7;Roche, Basel, Switzerland) according to the manufacturer’s instructions. Photomicrographs were obtained using a bright-field microscope (Leica DM5000B).