Fastpure gel dna extraction mini kit

The T-DNA flanking sequences inserted into the genome were cloned using thermal asymmetric interlaced PCR (TAIL-PCR) protocol with minor modification (Liu et al., 1995 (link); Mullins et al., 2001 (link)). Right border primers (R1, R2, and R3) and left border primers (L1, L2, and L3) and arbitrary degenerate primers (AD1, AD2, and AD-3) were utilized for TAIL-PCR (Table 1). PCR conditions were set as described by Mullins and Sessions (Mullins et al., 2001 (link); Sessions et al., 2002 (link)), with minor modifications (Supplementary Table S1). The third TAIL-PCR products of all transformants displaying the highest brightness were purified using the FastPure Gel DNA Extraction Mini Kit (Vazyme, China). This fragment was ligated to the vector pTOPO-Blunt, which was transferred into Escherichia coli strain Top10 using a CV16-Zero Background pTOPO-Blunt Cloning Kit (Aidlab, China). E. coli harboring the pTOPO-Blunt vector was sequenced by Sangon Biotech Company (Shanghai, China). To isolate the tagged genes, the sequences flanking the T-DNA of each transformant were used to search the local genome database of WT C. magnum by BLAST+.¹ Gene structure was predicted using the C. fioriniae, C. gloeosporioides, C. graminicola, C. higginsianum, C. orbiculare, and C. sublineola by the FGENESH program.²

The AxyPrep Body Fluid Viral DNA/RNA Miniprep Kit (Axygen, Hangzhou, China) was used to extract the viral DNA from the supernatant of the tissue homogenate following the manufacturer’s instructions. For clinical diagnosis, the partial UL6 gene was amplified in a 25 μL reaction mixture: 12.5 μL of 2 Taq Plus Master Mix II (Vazyme, Nanjing, China), 1 μL of each primer (DVEV-F: GAGCGTATTTAGTAGAAACTGC; DVEV-R: TGAATGTTGTGATTGTTC): (10 µM) [23 (link)], 9 μL of nuclease-free water, and 2 μL of template DNA. The target UL6 gene was amplified under the following conditions: initial denaturation at 95 °C for 5 min; 35 cycles of denaturation at 95 °C for 30 s; annealing at 53 °C for 30 s; and extension at 72 °C for 30 s. The final extension was performed for 10 min at 72 °C. The PCR products were analyzed on a 2% agarose gel at 120 V for 30 min. Specific fragment bands were extracted using the FastPure Gel DNA Extraction Mini Kit (Vazyme, Nanjing, China). The PCR products were subcloned into the pMD 18-T vector (Takara, Dalian, China) and sequenced using Sanger sequencing (Sangon Biotech, Guangzhou, China).

A set of primers composed of UL2-F: 5-ATGACAGAACCTGCCACGGAAAC-3 and UL2-R: 5-TTATACTGTTCCACAAGGAAGTTGC-3 was designed to amplify the complete UL2 gene (1002 bp) according to the UL2 gene sequences of DPV strains deposited in GenBank. Furthermore, the UL12, UL41, UL47, and LORF11 genes with an expected size of 1689 bp, 1494 bp, 2364 bp, and 4341 bp, respectively, were amplified with the primers described by Wang et al. [25 ]. These genes were amplified in a 25 μL reaction: 12.5 μL 2 × Taq Plus Master Mix II (Vazyme, Nanjing, China), 1 μL of each primer (10 µM), 9 μL of nuclease-free water (Servicebio, Wuhan, China), and 2 μL template DNA. The PCR parameters were as follows: initial denaturation at 95 °C for 5 min; 35 cycles of denaturation at 95 °C for 30 s; annealing at 52 °C for 30 s; and extension at 72 °C (LORF11 for 3 min 40 s, UL12 for 2 min, UL41 for 1 min 30 s, and UL47 for 2 min 30 s). The final extension was kept at 72 °C for 10 min. The PCR products were purified using the FastPure Gel DNA Extraction Mini Kit (Vazyme) according to the manufacturer’s instructions. The purified PCR products were subcloned into the pMD 18-T vector (Takara) and then sequenced by Sanger sequencing.

Total RNA from young staminate strobilus (collected on 26 March) were used to obtain cDNA using a reverse transcription kit (Monad Biotech Co., Ltd., Nanjing, China). The full length CDS was amplified with three pairs of specific primers (Table S7). The PCR procedure was as follows: 95 °C for 3 min, followed by 35 cycles of 95 °C for 15 s, 60 °C for 15 s, 72 °C for 52 s in GbARF6a and for 130 s in GbARF10b and GbARF10a, finally at 72 °C for 5 min. The amplified products were injected in 1% agarose gel to move the positive side of the gel bath with voltage of 120 V and the quality of products were observed on a gel imager. The gel blocks containing the target genes were purified using FastPure^® Gel DNA Extraction Mini Kit (Vazyme Biotech Co., Ltd., Nanjing, China), then ligated into the clone vector pClone007 Blunt Simple Vector (Tsingke, Nanjing, China), and transferred into DH5α strain (Tsingke, Nanjing, China). The resuscitation solution was spread on LB solid medium, then put in 37 °C incubator to dark culture for 16 h, the positive clones were identified and sequenced to verify their genomic sequences.

A DNA fragment corresponding to −154 to + 247 of the Pae alpB promoter followed by Mango III coding sequence was synthesized and inserted into pUC57 (GENEWIZ, Inc.). The DNA fragment was amplified by PCR, was purified using the FastPure Gel DNA Extraction Mini Kit (Vazyme, Inc.), and was stored at −80°C. Pae alpB promoter derivatives were prepared using site-directed mutagenesis. Transcription antitermination assay was performed in a 384-well microplate format. Reaction mixtures contained (50 μl): 0 or 0.1 μM AlpA, 0 or 0.1 μM GreB, 0 or 0.2 μM NusA, 0.1 μM Pae RNAP-σ⁷⁰ holoenzyme, 20 nM DNA fragment, 1 μM TO1-Biotin, 0.2 mM ATP, 0.2 mM UTP, 0.2 mM GTP, 0.2 mM CTP, 50 mM Tris–HCl, pH 8.0, 0.1 M KCl, 10 mM MgCl₂, 1 mM DTT and 5% glycerol. Following incubation for 15 min at 37°C, fluorescence emission intensities were measured using an Infinite M200 Pro microplate reader (TECAN, Inc.; excitation wavelength = 500 nm; emission wavelength = 540 nm).

Double stranded DNA probes were radiolabeled with Fluorophore 6-carboxy-fluorescein (FAM) and purified by FastPure Gel DNA Extraction Mini Kit (Vazyme). For the EMSA, DNA probe was incubated with Cbl protein samples in reaction buffer (10 mM Tris–HCl, one mM MgCl₂, one mM DTT, 40 mM KCl, 0.1 mg/mL BSA, 5% (w/v) glycerol) at 37 °C for 30 min. After the samples were separated using a 6% native acrylamide gel (Zhang et al., 2020 (link)), the gel was then exposed to a phosphorscreen and visualized on Typhoon FLA 9500.

Genomic identification was based on 16 S rRNA gene sequencing. Genomic DNA was purified with an Ezup Column Bacteria Genomic DNA Purification Kit (Sangon Biotech, Shanghai, China) and used as a template for amplification of 16 S rRNA, using the following primers: forward (5′-AGAGTTTGATCCTGGCTCAG-3′) and reverse (5′-GGTTACCTTGTTACGACTT-3′). Initial denaturation at 94 °C for 5 min was followed by 30 cycles at 94 °C for 30 s, 50 °C for 30 s, 72 °C for 1 min, plus final extension at 72 °C for 10 min. The amplified 16 S rRNA fragment was sliced from the 1% agarose gel, purified using a FastPure Gel DNA Extraction Mini Kit (Vazyme, Nanjing, China) and the resulting fragment submitted to Sangon Biotech (Shanghai, China) for nucleotide sequencing and comparison to the nucleotide database of NCBI using the BLAST nucleotide. A multiple sequence alignment program, CLUSTAL-W in MEGA X software, was used to align nucleotide sequences and to prepare a phylogenetic tree using the Neighbor-Joining tree approach.