Sigmaspin post reaction clean up columns

Manufactured by Merck Group

Sourced in United States

The SigmaSpin™ Post-Reaction Clean-Up Columns are a laboratory equipment product designed for the purification of reaction mixtures. These columns facilitate the removal of unwanted components, such as salts, enzymes, or small molecules, from the desired product after a chemical reaction. The core function of these columns is to provide a simple and efficient way to purify samples prior to further analysis or characterization.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

SigmaSpin columns (4 citations)

9 protocols using sigmaspin post reaction clean up columns

Molecular Pathogenicity Determination

Check if the same lab product or an alternative is used in the 5 most similar protocols

In vitro (molecular) pathogenicity determination was conducted based on the sequencing of the F gene of all 14 viruses and determination of their cleavage sites of the deduced amino acid sequences. A one-step reverse transcription polymerase chain reaction (RT-PCR) was run in 25µL volume according to and using primers of Kim et al.13 (link) The PCR products were separated by gel electrophoresis on 1.5% agarose gel (biotechnology grade or electrophoresis grade). The PCR products were excised and eluted from the agarose gel using QIAquick^® Gel Extraction Kit following the manufacturer's recommendations. The amount of PCR product elutes from the agarose gel were then estimated by Nanodrop spectrophotometry (PeQLab Biotechnology, GmbH, Germany) and subsequently used for sequencing.
The amplicon was sequenced in both directions using the amplification primers using the Big Dye^TM Terminator Cycle Sequencing Kit and an ABI Prism^® DNA Sequencer (3130 Genetic Analyzer, Applied Biosystems). The gene sequencing reaction product was cleaned by Sigma Spin Post-Reaction Clean-Up Columns according to the manufacturer’s instructions (Sigma). The nucleotide sequences generated using Sanger Sequencer (sequence analyser) (Applied Biosystems) were edited by Chromas Lite software (Technelysium Pty Ltd, Australia) and used for molecular characterization.

Bari F.D., Gelaye E., Tekola B.G., Harder T., Beer M, & Grund C. (2021). Antigenic and Molecular Characterization of Virulent Newcastle Disease Viruses Circulating in Ethiopia Between 1976 and 2008. Veterinary Medicine : Research and Reports, 12, 129-140.

+ Open protocol

+ Expand

In Situ Hybridization Probes for asc and caspa

Check if the same lab product or an alternative is used in the 5 most similar protocols

In situ hybridization was performed essentially as described previously (Thisse and Thisse, 2008 (link)). Antisense and sense probes for asc and caspa coding DNA sequence (CDS) were transcribed in vitro from linearized pCS2 + DNA vector containing the entire CDS of each gene with the DIG RNA labeling kit (Roche) and purified with SigmaSpin Post-Reaction Clean-Up columns (Sigma-Aldrich). BM Purple AP substrate (Roche) was used for staining. Whole-mount, in situ samples were sectioned using the Historesin-embedding kit (Leica Biosystems), according to manufacturer’s instructions. Sectioning was performed manually using RM2235 manual rotary microtome (Leica Biosystems).

Kuri P., Schieber N.L., Thumberger T., Wittbrodt J., Schwab Y, & Leptin M. (2017). Dynamics of in vivo ASC speck formation. The Journal of Cell Biology, 216(9), 2891-2909.

+ Open protocol

+ Expand

Loss of Heterozygosity Analysis for Tsc2

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mouse Tsc2 LOH analysis was performed on tissue from Tsc2 heterozygote mice, as described by Onda et al (24 (link)), after micro-dissection of paraffin-embedded sections under ×100 magnification. When the wild-type allele was present at less than 50% of the mutant allele, this was judged as evidence of LOH. Human TSC2 LOH analysis was undertaken by combining methodologies from Smolarek et al. (31 (link)) and Lesma et al. (32 (link)). Micro-dissected areas of tissue were verified for tuberin immunoreactivity from serial sections. Microsatellite markers, Kg8, D16S283, D16S291 and D16S525 that are within 600 kb of TSC2 locus on chromosome 16p13.3 were examined (33 (link),34 (link)). PCR was performed with 6-FAM-labelled sense primers (Invitrogen). PCR was performed as described by Lesma et al. (32 (link)). The PCR products were purified using SigmaSpin Post-Reaction Clean-up Columns (Sigma-Aldrich) and underwent fragment analysis (Genewiz). Samples were examined using the program peak scanner (ABI) to view amplicant peaks. All analysis was repeated at least twice for confirmation.

D’Armiento J., Shiomi T., Marks S., Geraghty P., Sankarasharma D, & Chada K. (2016). Mesenchymal tumorigenesis driven by TSC2 haploinsufficiency requires HMGA2 and is independent of mTOR pathway activation. Cancer research, 76(4), 844-854.

+ Open protocol

+ Expand

Cloning and Sequencing of β-Globin

Check if the same lab product or an alternative is used in the 5 most similar protocols

In order to clone the fragment containing the β-globin gene promoter in a pBluescript II SK (pSK) vector, β_KpnI and β_XhoI primers, engineered to contain both KpnI and XhoI restriction site, respectively, were used.
The entire proband's β-globin gene was amplified and sequenced. Polymerase Chain Reactions (PCR) were performed as described in Table 1 by using the primers shown in Table 2. All amplified products were electrophoresed through a 1–1.2% agarose, 1x TAE, and ethidium bromide stained gel at 7.5 volts/cm for 45′ in the presence of a molecular weight marker. DNA was recovered from agarose by means of the Montage Gel Extraction Kit (Merck Millipore, Darmstadt, Germany). The purified fragments were sequenced by terminator chemistry (BigDye Terminator v3.1 Cycle Sequencing Kit, Applied Biosystems, Foster City, CA, USA). Reaction mix was purified through the Sigma Spin Postreaction Clean-Up Columns (Sigma-Aldrich, Saint Louis, MO, USA) and subjected to capillary electrophoresis on an ABI PRISM 3130 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA). Another Plasmid Editor APE (http://biologylabs.utah.edu/jorgensen/wayned/ape/) was used to align the obtained sequences with the reference (AC #: U01317).

Pirastru M., Mereu P., Nguyen C.Q., Nguyen N.V., Nguyen T.D, & Manca L. (2017). A Novel -72 (T→A) β-Promoter Mutation Causing Slightly Elevated HbA2 in a Vietnamese Heterozygote. BioMed Research International, 2017, 4537409.

+ Open protocol

+ Expand

Cloning and Riboprobe Synthesis of Zebrafish smarcad1

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Full-length coding regions of zebrafish smarcad1 genes were amplified by RT-PCR using gene-specific primers designed according to the current DNA sequence in Ensembl. Phusion^® High-Fidelity DNA Polymerase master mix (New England Biolabs) was used for PCR amplification. PCR primers used here are listed in Table S1. The PCR products were purified using Zymo Gel Extraction Kit (Zymo Research) before they were cloned into the pJet1.2 vector using the CloneJET PCR Cloning Kit (Thermo Scientific). Gene inserts orientation was verified by Sanger sequencing. Riboprobes were synthesized through in vitro transcription using T7 DNA polymerase (New England Biolabs) and DIG RNA Labeling Mix (Roche). Then, the riboprobes were purified by SigmaSpin™ post-reaction clean-up columns (Sigma, S5059). Whole-mount in situ hybridization was carried out according to our previously published method.^{54 (link),55 (link)} For histological analysis, post-hybridization embryos were equilibrated in 15% sucrose, then 30% sucrose in 20% gelatin, after which they were embedded in 20% gelatin for cryosectioning (6–12 μm). Images were acquired using AxioCam MRc camera on Zeiss SteREO Discovery.V12 and Axio Imager 2 compound microscope.

Han H., Jiang G., Kumari R., Silic M.R., Owens J.L., Hu C., Mittal S.K, & Zhang G. (2021). Loss of smarcad1a accelerates tumorigenesis of malignant peripheral nerve sheath tumors in zebrafish. Genes, Chromosomes & Cancer, 60(11), 743-761.

+ Open protocol

+ Expand

Zebrafish in situ hybridization protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Whole-mount in situ hybridizations on zebrafish samples were performed as described by (86 (link)). ncoa3 in situ probe was synthesised in vitro from a PCR product (880 bp amplified from exon11) using a T7 RNA Polymerase for transcription (ThermoFisher Scientific) and DIG-labelling Mix (Roche)followed by purification with SigmaSpin™ Post-Reaction Clean-Up Columns (Sigma Aldrich). The following primers were used for the PCR: ncoa3-F (5’GAATACCTTCTCTAGCAGCTCATTG3’) and ncoa3-R (5’taatacgactcactatagggagCTTATTGAGGAGGTAGTGAAGGAGG3’).

Salazar-Silva R., Dantas V.L., Alves L.U., Batissoco A.C., Oiticica J., Lawrence E.A., Kawafi A., Yang Y., Nicastro F.S., Novaes B.C., Hammond C., Kague E, & Mingroni-Netto R.C. (2020). NCOA3 identified as a new candidate to explain autosomal dominant progressive hearing loss. Human Molecular Genetics, 29(22), 3691-3705.

+ Open protocol

+ Expand

Mitochondrial DNA D-loop Amplification and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

The primer pair CR1-CR2 (Sanna et al., 2015) was used to amplify the mtDNA D-loop fragment. A standard 50 μL PCR mixture was used, including 200 ng DNA template, 2.5 mM MgCl₂, 0.2 0 mM each dNTP, 0.20 μM each primer, 0.02 mM BSA, 1 × PCR buffer and 2 units Taq DNA Polymerase (Sigma-Aldrich), according to Mereu et al.^{32 (link)}. PCR amplifications were performed in a Gradient Thermocycler (Eppendorf) by an initial denaturation of 95 °C for 3 min, followed by 30 cycles of 95 °C for 50 s, 60 °C for 30 s, and 72 °C for 1 min.
PCR products were sequenced using the same primers on an ABI 3130 Genetic Analyzer (Applied Biosystem). Sequencing reactions were carried out following the manufacturer's recommendations (BigDye Terminator 3.1 Cycle Sequencing Kit—Applied Biosystem) and purified through the SigmaSpin Post—Reaction Clean—UP Columns (Sigma-Aldrich).
Raw sequencing data were processed by means of the KB base-calling algorithm implemented in the Sequencing Analysis Software 5.3.1 (Applied Biosystem).

Satta V., Mereu P., Barbato M., Pirastru M., Bassu G., Manca L., Naitana S, & Leoni G.G. (2021). Genetic characterization and implications for conservation of the last autochthonous Mouflon population in Europe. Scientific Reports, 11, 14729.

+ Open protocol

+ Expand

Spatial Expression Analysis of zebrafish smarcad1 Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Full‐length coding regions of zebrafish smarcad1 genes were amplified by RT‐PCR using gene‐specific primers designed according to the current DNA sequence in Ensembl. Phusion® High‐Fidelity DNA Polymerase master mix (New England Biolabs) was used for PCR amplification. PCR primers used here are listed in Table S1. The PCR products were purified using Zymo Gel Extraction Kit (Zymo Research) before they were cloned into the pJet1.2 vector using the CloneJET PCR Cloning Kit (Thermo Scientific). Gene inserts orientation was verified by Sanger sequencing. Riboprobes were synthesized through in vitro transcription using T7 DNA polymerase (New England Biolabs) and DIG RNA Labeling Mix (Roche). Then, the riboprobes were purified by SigmaSpin™ post‐reaction clean‐up columns (Sigma, S5059). Whole‐mount in situ hybridization was carried out according to our previously published method.⁵⁴, ⁵⁵ For histological analysis, post‐hybridization embryos were equilibrated in 15% sucrose, then 30% sucrose in 20% gelatin, after which they were embedded in 20% gelatin for cryosectioning (6–12 μm). Images were acquired using AxioCam MRc camera on Zeiss SteREO Discovery.V12 and Axio Imager 2 compound microscope.

+ Open protocol

+ Expand

Zebrafish ncoa3 in situ probe synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Whole-mount in situ hybridizations on zebrafish samples were performed as described by (39) . ncoa3 in situ probe was synthesised in vitro from a PCR product(880 bp amplified from exon11) using a T7 RNA Polymerase for transcription (ThermoFisher Scientific) and DIG-labelling Mix (Roche)followed by purification with SigmaSpin™ Post-Reaction Clean-Up Columns (Sigma Aldrich). The following primers were used for the PCR: ncoa3-F
(5'GAATACCTTCTCTAGCAGCTCATTG3') and ncoa3-R
(5'taatacgactcactatagggagCTTATTGAGGAGGTAGTGAAGGAGG3').

Salazar-Silva R., Dantas V.L.G., Alves L.U., Batissoco A.C., Oiticica J., Lawrence E.A., Kawafi A., Yang Y., Nicastro F.S., Novaes B.C.d.A.C., Hammond C.L., Kague É., & Mingroni‐Netto R.C. (2020). NCOA3identified as a new candidate to explain autosomal dominant progressive hearing loss.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!