Pierce agarose chip kit

Quantitative Chromatine Immunoprecipitation (ChIP) analysis was performed with the Pierce Agarose ChIP Kit (Pierce Biotechnology, IL). All reagents were prepared as described by the manufacturer. Briefly, samples were cross- linked with 1.0% formaldehyde. Anti-GR antibody (Thermo Fischer Scientific) was used with Protein A/G plus Agarose to adsorb immune-specific complexes. Normal rabbit IgG was used as the negative control. Finally, purified DNA was analyzed by real-time PCR (Applied Biosystems, Monza, Italy) using appropriate primers. ChIP-qPCR data were normalized by using the Fold Enrichment Method. Each sample was analyzed in triplicate. Each experiment was performed on at least three separate occasions.
The following primers were used to amplify segments that overlap with the appropriate regions:
nGRE1 fw: CAGGACATGTCTTCCCTCTCT, nGRE1 rev: CCCGTAGTGCTCCGATAAGTA
mapping at about −800 bp.
nGRE2 fw: TAAACAGTGCTGGAGGCTGG, nGRE2 rev: GTGAGGGGCTCTCATGGTGTC
overlapping the TATA box.

ChIP was performed using Pierce Agarose ChIP Kit (Thermo Fisher Scientific, Rockford, IL, USA) according to the manufacturer’s instructions. The following antibodies were used: c-Myc (Santa Cruz Biotech, sc-42x) and rabbit IgG (Abcam, ab46540). Immunoprecipitated DNA was analyzed by qPCR. All primers for ChIP-qPCR are listed in Supplementary Material: Table S2.

Protein-DNA interaction was detected using the Pierce™ Agarose ChIP Kit (Thermo Fisher Scientific). Briefly, the cells are cross-linked using formaldehyde solution, and chromatin was sheared by enzymatic digestion with micrococcal nuclease (Thermo Fisher). The chromatin was incubated overnight at 4 °C with antibodies to MYH11, DNMT3A, DNMT3B and 20 μL protein A/G plus agarose at 4 °C, with antibody to IgG as a control. All antibodies were supplied by Thermo Fisher. After immunoprecipitation elution and DNA recovery, the purified DNA was subjected to qPCR.

Chromatin immunoprecipitation (ChIP) was performed according to the instructions of the Pierce Agarose ChIP Kit (Thermo Fisher Scientific, Cat. No. 26156, Waltham, MA, United States). The E2F1 binding site on the PTTG1 promoter region (NC_000005.10, 1,60419855–160421854) was predicted using the JASPAR online tool (http://jaspar.genereg.net/). A fluorescence quantitative PCR was carried out using PTTG1 promoter specific primers (Supplementary Table S2). The relative expression levels of interested PTTG1 promoter regions were calculated as a ratio normalized to GAPDH (primers are provided by the ChIP kit) expression when E2F1 was knocked down and negative control for 48 h in NCI-H460 cells. A comparative quantification was performed using the 2^−ΔΔCt method.

ChIP assay was carried out using Pierce Agarose ChIP Kit (26156, Thermo) as described previously [11 (link), 35 (link)]. In brief, cells (2×10⁶) plated in 100 mm culture dishes were treated with 1% formaldehyde to cross-link proteins to DNA. The cell lysates were sonicated to shear DNA to sizes of 300-1000 bp lengths. DNA-protein complexes were immunoprecipitated with 2 μg anti-RelA antibody or 2 μg anti-IgG antibody as a negative control. The immunoprecipitates were eluted and reverse crosslinked to purify the DNA fragments. Immunoprecipitated and input DNAs were subjected to RT-qPCR analysis. The specific primers for amplifying RelA-binding regions are as follows: VEGFA: 5′-TGCTCCTGGGGTGCTAGA-3′ (forward) and 5′-ACAATAAGAGTTAAGCAG-3′ (reverse); miR-19a: 5′-CTGGCTTCTCAGTG TGTTAT-3′ (forward) and 5′-CTGGAAATCTGACATGTAATC-3′ (reverse). The amount of precipitated DNA was calculated as the percentage of input sample and each sample was detected in triplicate.