To generate a T2A-QF2/FLP donor vector for acj6 (we used the same strategy for run, CG14322 and lov), a ~2000 bp genomic sequence flanking the stop codon of acj6 was PCR amplified and introduced into pCR-Blunt II-TOPO (ThermoFisher Scientific #450245), forming pTOPO-acj6. To build pTopo-acj6-T2A-QF2, T2A-QF2 including loxP-flanked 3xP3-RFP was PCR amplified from pBPGUw-HACK-QF2 (Addgene #80276), followed by insertion into pTOPO-acj6 right before the stop codon of acj6 by DNA assembly (New England BioLabs #E2621S). To generate T2A-FLP, we PCR-amplified FLP from the genomic DNA of GH146-FLP strain. QF2 in pTopo-acj6-T2A-QF2 was then replaced by FLP through DNA assembly. Using CRISPR Optimal Target Finder (Gratz et al., 2014 (link)), we selected a 20 bp gRNA target sequence that flanked the stop codon and cloned it into pU6-BbsI-chiRNA (Addgene #45946). If the gRNA sequence did not flank the stop codon, silent mutations were introduced at the PAM site of the donor vector by site-directed mutagenesis. Donor and gRNA vectors were co-injected into Cas9 embryos in-house or through BestGene.
Pu6 bbsi chirna
Manufactured by Addgene
The PU6-BbsI-chiRNA is a plasmid designed for the expression of CRISPR guide RNAs (gRNAs). It contains a U6 promoter for the expression of the gRNA and BbsI restriction sites for the convenient cloning of target sequences.
Automatically generated - may contain errors
Lab products found in correlation
Pbs hsp70 cas9, by Addgene (2 mentions)
Pdsred attp, by Addgene (2 mentions)
Pcr blunt 2 topo, by Thermo Fisher Scientific (1 mentions)
One shot top10 competent cells, by Thermo Fisher Scientific (1 mentions)
In fusion cloning kit, by Takara Bio (1 mentions)
Sanger sequencing, by Eurofins (1 mentions)
12 protocols using pu6 bbsi chirna
1
T2A-QF2/FLP Donor Vector Generation
2
CRISPR gRNA Constructs Cloning
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
gRNA constructs cloning: Cloning of the gRNA constructs was performed following protocols published online on the website (CRISPR fly Design - http://www.crisprflydesign.org/ ) and injection mixes were prepared according to protocols described by Gratz et al. (Gratz et al., 2013a (link)). Oligos were designed with 20 nucleotides of the target genome sequence with additional 5’ overhangs that are complementary to BbsI restriction sites (sense: 5’ CTTC-GN19 3’) (antisense: 5’ AAAC-N19C 3’). The oligos were synthesized de novo, then annealed in T4 ligation buffer and cloned into the pU6-BbsI-chiRNA plasmid. Following successful cloning, the gRNA plasmids were transformed into One Shot TOP10 competent cells (Invitrogen #C4040) and plated for transformant screening. For cloning single and double gRNA constructs, in this study we have used: pU6-BbsI-chiRNA which was a gift from Melissa Harrison and Kate O'Connor-Giles and Jill Wildonger (Addgene plasmid # 45946), pCFD3-dU6:3gRNA was a gift from Simon Bullock (Addgene plasmid # 49410) and pCFD4-U6:1_U6:3tandem-gRNAs was a gift from Simon Bullock (Addgene plasmid # 49411).
3
CRISPR Knock-in Protocol with dsRED Fluorescent Marker
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Homology arms 1 and 2 were PCR amplified using the oligos mentioned below in the ‘Oligo’ section, and then cloned into pHD-pDsRed-attP (addgene #51019) via AarI (arm1) and SpeI-XhoI (arm2) restriction sites. Two guide RNAs were each cloned into pU6-BbsI-chiRNA (addgene #45946) via BbsI. The donor vector and both gRNA vectors were injected together into nos-Cas9 embryos (Bloomington 54591). Hatching flies were crossed to balancer stocks and resulting F1 flies were screened for dsRED fluorescence.
4
CRISPR/Cas9-Mediated Deletion of Gr64 Cluster
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We used CRISPR/Cas9 system to generate Gr64af flies [48 (link)]. We selected two target sites for deletion of the whole Gr64 cluster using DRSC Find CRISPRs (http://www.flyrnai.org/crispr ) and CRISPR optimal target finder (http://tools.flycrispr.molbio.wisc.edu/targetFinder ): one near the 5’ end of Gr64a (GAATCCTCAACAAACTTCGGTGG , the Protospacer Adjacent Motif is underlined) and one near the 3’ end of Gr64f (GGTCGTTGTCCTCATGAAATTGG ). We synthesized oligomers and cloned them into the BbsI site on pU6-BbsI-ChiRNA (Addgene #45946). After injecting two pU6-ChiRNA targeting constructs into nos-Cas9 embryos at 500 ng/μl each, we screened the resulting flies for deletions via PCR of genomic DNA isolated from the G0 generation. The primers we used for deletion confirmation were as follows: TCTCGGCAGCTAATCGAAAT and GCGACCATTCTTTGTGGAAT.
5
Drosophila RNAi and Genetic Manipulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following Drosophila stocks were used: UAS-Vha68-2RNAi (34390; Vienna Drosophila Resource Center [VDRC] and BL34582; Bloomington Drosophila Stock Center), UAS-Vha100-2RNAi (30297; VDRC), UAS-VhaAC39-1RNAi (20950; VDRC), E(spl)mγ-GFP (Almeida and Bray, 2005 (link)), NRE-LacZ; esg-GAL4, UAS-GFP, tubulin-GAL80ts (Lucchetta and Ohlstein, 2017 (link)), UAS-NotchRNAi (100002; VDRC), UAS-NotchΔECD (Larkin et al., 1996 (link)), UAS-bratRNAi (31333; VDRC), and UAS-mCherryRNAi (BL35785). The following GAL4 driver lines were used: UAS-dcr2; ase-GAL4, UAS-stingerGFP (Barolo et al., 2000 (link)), ase-GAL4 (Zhu et al., 2006 (link)), UAS-dcr2; wor-GAL4, ase-GAL80 (Neumüller et al., 2011 (link)), UAS-stingerRFP (Homem et al., 2014 (link)), and esg-GAL4, UAS-mCD8::GFP, tubulin-GAL80ts (Goulas et al., 2012 (link)).
Stock generated in this study was Vha68-2-GFP. gRNA was cloned into pU6-BbsI-chiRNA (45946; 100 ng/μl; Addgene) and coinjected with the donor plasmid (250 ng/μl) into act>Cas9 embryos. The gRNA used was GGAGGACTAGAGACCGCGC.
Fly crosses were set up at 25°C for 24 h and then shifted to 29°C. For experiments inFig. 7 (b–f) , fly crosses were set up and reared at 18°C. 3-d-old female flies were shifted to 29°C for 6 d. For the brat rescue, double RNAi crosses were set up and reared at 29°C. Flies were collected 2 d after eclosion and kept at 29°C.
Stock generated in this study was Vha68-2-GFP. gRNA was cloned into pU6-BbsI-chiRNA (45946; 100 ng/μl; Addgene) and coinjected with the donor plasmid (250 ng/μl) into act>Cas9 embryos. The gRNA used was GGAGGACTAGAGACCGCGC.
Fly crosses were set up at 25°C for 24 h and then shifted to 29°C. For experiments in
6
CRISPR-HDR-Mediated npfr Gene Modification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We employed CRISPR-HDR (Kondo and Ueda, 2013 (link); Ren et al., 2013 (link)) to generate the npfrLexA mutant with the LexA knockin. We chose the upstream and a downstream guide RNAs targeting the third exon using the CRISPR Optimal Target Finder.
We annealed the following upstream and downstream primer dimers, which we cloned into the BbsI site of pU6-BbsI-ChiRNA (Addgene #45946).
We amplified the npfr upstream (1426 bp, nucleotides 3 R:6190969 to 6192394, release = r 6.16) and downstream (1250 bp, nucleotides 3 R:6192051 to 6193300, release = r 6.16) homology arms using the following primers:
We used the In-Fusion cloning kit (Clontech) to clone the upstream and downstream homology arms into the KpnI and NdeI sites of pBPLexA::p65Uw (Addgene #26231).
The pU6-BbsI-ChiRNA-npf_up, and pU6-BbsI-ChiRNA-npf_down, pBPLexA::p65Uw-npf_LA + RA plasmids were co-injected into the BDSC #55821 strain (BestGene Plan R), which provided the source of Cas9.
We used the following primers to genotype the transformants (as shown inFigure 7—figure supplement 1 ):
The following primers were used to amplify npfr cDNA, which we obtained by performing RT-PCR using mRNA extracted from npfrLexA and control flies:
We annealed the following upstream and downstream primer dimers, which we cloned into the BbsI site of pU6-BbsI-ChiRNA (Addgene #45946).
We amplified the npfr upstream (1426 bp, nucleotides 3 R:6190969 to 6192394, release = r 6.16) and downstream (1250 bp, nucleotides 3 R:6192051 to 6193300, release = r 6.16) homology arms using the following primers:
We used the In-Fusion cloning kit (Clontech) to clone the upstream and downstream homology arms into the KpnI and NdeI sites of pBPLexA::p65Uw (Addgene #26231).
The pU6-BbsI-ChiRNA-npf_up, and pU6-BbsI-ChiRNA-npf_down, pBPLexA::p65Uw-npf_LA + RA plasmids were co-injected into the BDSC #55821 strain (BestGene Plan R), which provided the source of Cas9.
We used the following primers to genotype the transformants (as shown in
The following primers were used to amplify npfr cDNA, which we obtained by performing RT-PCR using mRNA extracted from npfrLexA and control flies:
7
CRISPR Deletion of the Bombardier Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The bombardier gene (CG18067) was deleted using CRISPR/Cas9 technology according to established protocols (26 (link)). Briefly, a pair of gRNAs designed to delete the region 2R: 20,534,248–20,536,154 were cloned into pU6-BbsI-chiRNA (Addgene plasmid #45946). Homology arms (1,017 bp left and 1,022 bp right) were cloned into pDsRed-attP (Addgene plasmid #51019). The plasmid pBS-Hsp70-Cas9 (Addgene plasmid #46294) was used as the Cas9 source. Constructs were injected into w1118 embryos. F1 progeny were screened for DsRed eyes and homozygous lines were established. See Supplemental Table 1 for gRNA and homology arm primer sequences.
8
CRISPR-Mediated Knock-In in Drosophila jeb
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We used CRISPR/Cas9 genome editing to induce homology-directed repair (HDR) in the Drosophila jeb locus108 (link),109 (link). The pBluescriptII KS[-] HDR donor construct (GenScript) contained homology arms (corresponding to 357 bp immediately upstream and 406 bp downstream of the jeb stop codon) that flanked a central segment encoding for a six amino acid linker (Gly-Ser-Gly-Gly-Ser-Ala), the transmembrane domain of Drosophila Neurotactin (Ala325-His347), a triple OLLAS-tag and a TAA stop codon. Two CRISPR target sites (AGCGGATGCGTTACTACGCTGGG and TGTGTGTGCTGTGTATTAGACGG) in close proximity to the endogenous jeb stop codon were identified using the flyCRISPR optimal target finder tool109 (link). Targeting gRNAs were cloned into pU6-BbsI-chiRNA (Addgene) as described109 (link). Donor and U6-chiRNA plasmids were injected into y1 M{vas-Cas9}ZH-2A embryos (BestGene Inc.). HDR-events were identified by single fly PCR screening using a primer combination specific to the knocked-in sequence (5′-GTTCCTCTTGCAGAGTGTCCT-3′ and 5′-CTAATTGTTTGTCA-ATGTGAGTTCGCT-3′). Candidates were further analyzed by Sanger sequencing (GATC Services—Eurofins Genomics) and tested for non-complementation with the jebweli null allele18 (link),36 (link).
9
Efficient CRISPR/Cas9-Mediated Genome Editing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pU6-chiRNA:sgRNA plasmid was obtained by incorporating the sgRNA sequence (obtained by annealing phos-gRNA-F and phos-gRNA-R, S1 Table ) into pU6-BbsI-chiRNA (Addgene plasmid # 45946) [22 (link), 23 (link)] following the protocol provided on https://flycrispr.org/protocols/ . Sequence was confirmed using the T3 universal primer.
A 123 nucleotide-long single-stranded oligodeoxynucleotide (ssODN) carrying the lysine (AAA) to alanine (GCC) substitution flanked by two 60 nucleotide-long homology arms was used as a template for Homology-Directed Repair (HDR) (synthetized by Integrated DNA Technologies Inc) (S1 Table ). The uL11 region of the recipient line vasa-Cas9 (BL-51324) was sequenced in order to respect possible polymorphisms. To prevent base pairing with the sgRNA, the ssODN was designed to be homologous to the PAM carrying strand.
A 123 nucleotide-long single-stranded oligodeoxynucleotide (ssODN) carrying the lysine (AAA) to alanine (GCC) substitution flanked by two 60 nucleotide-long homology arms was used as a template for Homology-Directed Repair (HDR) (synthetized by Integrated DNA Technologies Inc) (
10
Genome Editing in Drosophila Using CRISPR
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!