Pyes2.1 v5 his topo

Manufactured by Thermo Fisher Scientific

Sourced in United Kingdom, United States

The PYES2.1/V5-His-TOPO is a plasmid vector designed for the expression and purification of recombinant proteins in Escherichia coli. It features a T7 promoter for high-level protein expression and a V5 epitope tag and a 6xHis tag for detection and purification of the expressed protein.

Automatically generated - may contain errors

Lab products found in correlation

S c easycomp transformation kit, by Thermo Fisher Scientific (2 mentions) Pcr2.1 topo vector, by Thermo Fisher Scientific (1 mentions) Escherichia coli top10 cells, by Thermo Fisher Scientific (1 mentions) Pyes2.1 v5 his topo vector, by Thermo Fisher Scientific (1 mentions) Invsc1, by Thermo Fisher Scientific (1 mentions) Taq pwo expand high fidelity pcr system, by Roche (1 mentions)

8 protocols using pyes2.1 v5 his topo

Heterologous Expression of Fatty Acid Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Protein coding genes (Table 1), codon-optimized for expression in B. napus, were synthesized (Geneart, Regensburg) and cloned into the yeast expression vector pYES2.1/V5-His-TOPO (Invitrogen) under the control of the Gal1 promoter. Each coding sequence contained a stop codon to prevent translation of C-terminal epitope tags. After confirming the sequences, plasmids were transformed into strain INVSc1 (Invitrogen), using the Sc EasyComp Transformation Kit (Invitrogen) and selected for the presence of the introduced plasmids on plates lacking the appropriate amino acids.
The fatty acid 20:4n-3 was not commercially available, and was generated in vivo by co-expression of d6Elo(Tp). For this purpose, the codon optimized d6Elo(Tp) gene was cloned into the yeast expression vector pESC-Leu under the control of the Gal1 promoter. Yeast strain INVSc1 (Invitrogen) was co-transformed with pESC-Leu containing d6Elo(Tp) and with pYES2.1/V5-His-TOPO containing other desaturase and elongase genes. Induction with galactose therefore resulted in the expression of d6Elo(Tp) and a second enzyme. Upon feeding with stearidonic acid (SDA, 18:4n-3), 20:4n-3 produced by d6Elo(Tp) was available as a substrate for the desaturase or elongase under investigation.

Yilmaz J.L., Lim Z.L., Beganovic M., Breazeale S., Andre C., Stymne S., Vrinten P, & Senger T. (2017). Determination of Substrate Preferences for Desaturases and Elongases for Production of Docosahexaenoic Acid from Oleic Acid in Engineered Canola. Lipids, 52(3), 207-222.

+ Open protocol

+ Expand

Generating re-integrant control strain for C. dubliniensis och1Δ

Check if the same lab product or an alternative is used in the 5 most similar protocols

To generate a re-integrant control strain for C. dubliniensis och1Δ, the primer pair 5′-GCGGCCGCAAAATGAAAAATATTTACC TC and 5′-GCGGCCGCTTGTTAGATTTAATTTGGATT (with bases added to create a NotI site underlined) were used to amplify by PCR a 2907 bpDNA fragment containing the C. dubliniensis OCH1 ORF plus 995 bp of its promoter and 731 bp of its terminator regions, and the DNA fragment cloned into pCR®2.1-TOPO® vector (Invitrogen, Paisley, UK). The insert was released by digesting with NotI, and subcloned into the NotI site of CIp10, generating plasmid CIp10-CdOCH1. The StuI-digested plasmid was integrated at the RPS1 locus generating strain NGY565.
The S. cerevisiae optimized, galactose-inducible protein expression vector pYES2.1/V5-His-TOPO (Invitrogen, Paisley, UK) was used to express S. cerevisiae OCH1 in the S. cerevisiae och1Δ null mutant strain. The S. cerevisiae OCH1 ORF was amplified by PCR (primer pair 5′-ATGTCTAGGAAGTTGTCCCACCTGA and 5′- GATGCTGATAAAAATGCAGGTCATAAATAA) and ligated into the pYES2.1/V5-His-TOPO vector according to manufacturers’ instructions and the construction used to transform Escherichia coli TOP10 cells (Invitrogen, Paisley, UK). The construction of pYES2.1/V5-His-TOPO was confirmed by sequencing and used to transform S. cerevisiae och1Δ null mutant.

Yadav B., Mora-Montes H.M., Wagener J., Cunningham I., West L., Haynes K., Brown A.J, & Gow N.A. (2020). Differences in fungal immune recognition by monocytes and macrophages: N-mannan can be a shield or activator of immune recognition. The Cell Surface, 6, 100042.

+ Open protocol

+ Expand

Characterizing Elongase Function in A. thaliana

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 49

To characterize the function of the A. thaliana elongases, the open reading frames of the DNAs in question were cloned downstream of the galactose-inducible GAL1 promoter of pYES2.1/V5-His-TOPO (Invitrogen), giving rise to pAt60 and pAt70.

The Saccharomyces cerevisiae strain 334 was transformed by electroporation (1500 V) with the vector pAt60 and pAt70, respectively. A yeast which was transformed with the blank vector pYES2.1 was used as the control. The transformed yeasts were selected on complete minimal dropout uracil medium (CMdum) agar plates supplemented with 2% glucose. After the selection, in each case three transformants were selected for the further functional expression.

To express the At elongases, precultures of in each case 5 ml of dropout uracil CMdum liquid medium supplemented with 2% (w/v) raffinose were inoculated with the selected transformants and incubated for 2 days at 30° C., 200 rpm.

5 ml of liquid CMdum medium (without uracil) supplemented with 2% raffinose and 300 μM of various fatty acids were then inoculated with the precultures to an OD₆₀₀of 0.05. The expression was induced by addition of 2% (w/v) galactose. The cultures were incubated for a further 96 hours at 20° C.

US10035989B2. Method for producing polyunsaturated fatty acids in transgenic plants (2018-07-31). BASF Plant Science GmbH [DE]. Inventors: Petra Cirpus [DE], Jörg Bauer [DE], Xiao Qiu [CA], Guohai Wu [CA], Nagamani Datla [CA].

+ Open protocol

+ Expand

Characterization of Ostreococcus tauri Δ6-Desaturase

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 29

To characterize the function of the desaturase OtDes6.1 (=Δ6-desaturase) from Ostreococcus tauri, the open reading frame of the DNA was cloned downstream of the galactose-inducible GAL1 promoter of pYES2.1/V5-His-TOPO (Invitrogen), giving rise to the corresponding clone pYES2.1-OtDes6.1. Further desaturase genes from Ostreococcus can be cloned analogously.

The Saccharomyces cerevisiae strain 334 was transformed by electroporation (1500 v) with the vector pYES2.1-OtDes6.1. A yeast which was transformed with the blank vector pYES2 was used as the control. The transformed yeasts were selected on complete minimal dropout uracil medium (CMdum) agar plates supplemented with 2% glucose. After the selection, in each case three transformants were selected for the further functional expression.

To express the OtDes6.1 desaturase, precultures of in each case 5 ml of dropout uracil CMdum liquid medium supplemented with 2% (w/v) raffinose were inoculated with the selected transformants and incubated for 2 days at 30° C., 200 rpm. 5 ml of CMdum liquid medium (without uracil) supplemented with 2% raffinose and 300 μm of various fatty acids were then inoculated with the precultures to an OD₆₀₀of 0.05. Expression was induced by addition of 2% (w/v) galactose. The cultures were incubated for a further 96 hours at 20° C.

+ Open protocol

+ Expand

Functional Expression of Insect pgFAR

Check if the same lab product or an alternative is used in the 5 most similar protocols

A yeast expression system (Invitrogen) was used to functionally express the S. exigua and S. littoralis pgFAR transcripts according to a previously described protocol7 (link)19 (link). We used pYES2.1/V5-His TOPO (Invitrogen) as a shuttle vector for the pgFAR transcripts, and the plasmids were transformed into Saccharomyces cerevisiae (INVSc1 strain, Invitrogen) according to the protocol listed in the SI Materials and Methods. For each test sample in the functional assay, we included a negative control (vector only) and a positive control (B. mori pgFAR)16 (link). All oligonucleotide primers and a synthetic gene representing the ORF of B. mori pgFAR were purchased from Integrated DNA Technologies (Belgium).

Antony B., Ding B.J., Moto K., Aldosari S.A, & Aldawood A.S. (2016). Two fatty acyl reductases involved in moth pheromone biosynthesis. Scientific Reports, 6, 29927.

+ Open protocol

+ Expand

Characterization of Thalassiosira Desaturases

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 34

To characterize the function of the desaturases from Thalassiosira pseudonana, the open reading frame of the respective DNA was cloned downstream of the galactose-inducible GAL1 promoter of pYES2.1/V5-His-TOPO (Invitrogen), giving rise to the corresponding pYES2.1 clone.

The Saccharomyces cerevisiae strain 334 is transformed by electroporation (1500 v) with the vectors pYES2.1-TpDesaturasen. A yeast which is transformed with the blank vector pYES2 is used as the control. The transformed yeasts are selected on complete minimal dropout uracil medium (CMdum) agar plates supplemented with 2% glucose. After the selection, in each case three transformants are selected for the further functional expression.

To express the Tp desaturases, initially precultures of in each case 5 ml of dropout uracil CMdum liquid medium supplemented with 2% (w/v) raffinose are inoculated with the selected transformants and incubated for 2 days at 30° C., 200 rpm. 5 ml of liquid CMdum medium (without uracil) supplemented with 2% raffinose and 300 μm of various fatty acids are then inoculated with the precultures to an OD₆₀₀of 0.05. The expression is induced by addition of 2% (w/v) galactose. The cultures are incubated for a further 96 hours at 20° C.

+ Open protocol

+ Expand

Heterologous Expression of F3'H Enzymes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Heterologous expression of the F3’H cDNA clones, which encode membrane bound enzymes, was performed in the yeast Saccharomyces cerevisiae according to established procedures [21 (link)]. F3’H cDNA clones were amplified with the Taq/Pwo Expand High Fidelity PCR System (Roche, Germany), and ligated into the vector pYES2.1/V5-His-TOPO (Invitrogen, USA). Plasmids were isolated and the presence and sense orientation of the insert was confirmed by sequencing (Microsynth Austria AG, Austria). The vectors containing the F3′H cDNAs of the four cultivars were transformed into the yeast strain INVSc1 using the Sc. EasyComp Transformation Kit (Invitrogen, USA). Heterologous expression and preparation of protein fractions were carried out as described previously [21 (link)]. Protein fractions were shock frozen in liquid nitrogen and stored at − 80 °C.

Nitarska D., Stefanini C., Haselmair-Gosch C., Miosic S., Walliser B., Mikulic-Petkovsek M., Regos I., Slatnar A., Debener T., Terefe-Ayana D., Vilperte V., Hadersdorfer J., Stich K, & Halbwirth H. (2018). The rare orange-red colored Euphorbia pulcherrima cultivar ‘Harvest Orange’ shows a nonsense mutation in a flavonoid 3’-hydroxylase allele expressed in the bracts. BMC Plant Biology, 18, 216.

+ Open protocol

+ Expand

Cloning and Functional Expression of Ostreococcus tauri Elongases

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 44

To characterize the function of the elongases from Ostreococcus tauri, the open reading frames of the respective DNAs were cloned downstream of the galactose-inducible GAL1 promoter of pYES2.1/V5-His-TOPO (Invitrogen), giving rise to pOTE1, pOTE1.2, pOTE2 and pOTE2.1.

The Saccharomyces cerevisiae strain 334 was transformed by electroporation (1500 V) with the vector pOTE1, pOTE1.2, pOTE2 and pOTE2.1, respectively. A yeast which was transformed with the blank vector pYES2 was used as the control. The transformed yeasts were selected on complete minimal dropout uracil medium (CMdum) agar plates supplemented with 2% glucose. After the selection, in each case three transformants were selected for the further functional expression.

To express the Ot elongases, precultures of in each case 5 ml of liquid CMdum medium supplemented with 2% (w/v) raffinose, but without uracil, were inoculated with the selected transformants and incubated for 2 days at 30° C., 200 rpm. 5 ml of liquid CMdum medium (without uracil) supplemented with 2% raffinose and 300 μm of various fatty acids were then inoculated with the precultures to an OD₆₀₀of 0.05. The expression was induced by addition of 2% (w/v) galactose. The cultures were incubated for a further 96 hours at 20° C.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!