The T. wilfordii suspension cells were cultured in Murashige and Skoog (MS) medium containing 30 g/L sucrose with 0.1 mg/L kinetin (KT), 0.5 mg/L indole-3-butytric acid (IBA) and 0.5 mg/L 2,4-dichlorophenoxyacetic acid (2,4-D), and maintained at 25 ± 1 °C with 120 rpm shaking in the dark as described previously3 (link). Farnesyl diphosphate ((E,E)-FPP), geranylgeranyl diphosphate (GGPP), (E)-nerolidol, (E,E)-geranyllinalool standards were purchased from Sigma-Aldrich Co. T4-DNA ligase and restriction enzymes were from New England Biolabs. The E. coli strains Trans5α and Transetta (DE3), and pEASY-Blunt Simple Cloning Kit were obtained from TransGen Biotech Co. Ltd. All reagents were purchased from Fisher, unless otherwise noted. Primers were synthesized by Shanghai Sangon Co., and automated DNA sequencing was conducted at Majorbio Co.
T4 dna ligase and restriction enzymes
Manufactured by New England Biolabs
Sourced in United States
T4 DNA ligase is an enzyme that catalyzes the formation of phosphodiester bonds between adjacent 3'-hydroxyl and 5'-phosphate termini in double-stranded DNA. Restriction enzymes are enzymes that cleave DNA at specific nucleotide sequences, creating defined DNA fragments.
Automatically generated - may contain errors
Lab products found in correlation
Qiaquick pcr purification kit, by Qiagen (3 mentions)
Qiaprep spin miniprep kit, by Qiagen (2 mentions)
Qiaquick gel extraction kit, by Qiagen (2 mentions)
Rtaq dna polymerase, by Takara Bio (2 mentions)
Masterpure gram positive dna purification kit, by Illumina (1 mentions)
Q5 high fidelity dna polymerase, by New England Biolabs (1 mentions)
Ni nta agarose, by Qiagen (1 mentions)
Plasmid extraction kit, by Merck Group (1 mentions)
Econo pac column, by Bio-Rad (1 mentions)
Hitrap, by Cytiva (1 mentions)
Annexin 5, by Biotium (1 mentions)
2 2 azino bis, by Merck Group (1 mentions)
Pgem t easy vector, by Promega (1 mentions)
Zeocin, by Thermo Fisher Scientific (1 mentions)
Ppiczαa, by Thermo Fisher Scientific (1 mentions)
3 aminobenzoic acid, by Merck Group (1 mentions)
Guaiacol, by Merck Group (1 mentions)
Genomic dna extraction kit, by Promega (1 mentions)
Ex taq dna polymerase, by Promega (1 mentions)
Pcdna3 vector, by Thermo Fisher Scientific (1 mentions)
14 protocols using t4 dna ligase and restriction enzymes
1
Cultivation of T. wilfordii suspension cells
2
Molecular Cloning and Plasmid Isolation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Oligonucleotides used in this study were synthesized by Eurofins Genomics (Ebersberg, Germany) and their sequences are listed in Table 3 . S. aureus chromosomal DNA was isolated using the MasterPure Gram-positive DNA purification Kit (Epicentre Biotechnologies, Madison, WI). Plasmid DNA was isolated using a QIAprep Spin Miniprep kit (Qiagen, Hilden, Germany) and PCR fragments were purified using the Qiaquick PCR purification kit (Qiagen). T4 DNA ligase and restriction enzymes, PCR reagents and Q5 high-fidelity DNA polymerase (New England Biolabs, Ipswich, MA) were used according to the manufacturer's recommendations. Nucleotide sequencing of plasmid constructs was carried out by Beckman Coulter Genomics (Danvers, MA).
3
Cloning and Expression of Acyl-PfACPs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All cloning steps were performed in E. coli NovaBlue cells (Novagen). Expression was conducted in E. coli BL21(DE3)-CodonPlus-RIL or C41(DE3) cells (Stratagene). Sources of supplies were as follows: pET vectors from Novagen; Pfu Turbo polymerase from Stratagene; T4 DNA ligase and restriction enzymes from New England Biolabs; plasmid extraction kits from Sigma; Terrific Broth medium from Difco; thrombin (T-3399) and acyl-CoAs from Sigma; NADH and NADPH from Roche Diagnostics; Calbiosorb resin from Calbiochem; Ni-NTA agarose from Qiagen; HiTrap Q XL and HisTrap HP columns from Amersham Biosciences; Econo-Pac columns from BioRad. All other supplies were reagent grade or better. An AEKTA FPLC (Amersham Biosciences) was used for protein purification. Spectrophotometric measurements were carried out on a Cary 50 conc Varian Spectrophotometer. Solutions were shaken using a Stuart see-saw rocker (SSL-4). Proteins were analyzed by conformational sensitive gel electrophoresis (15% CS-PAGE) [34] (link), [35] (link), [36] (link) using gels routinely containing 5 M urea and polymerized overnight, standard 10% SDS-PAGE [37] (link) and 10% Tris-Tricine SDS-PAGE [38] (link). Identity and homogeneity of acyl-PfACPs was confirmed by MALDI-TOF-MS. Protein concentrations were measured using the Bradford assay and BSA as a standard [39] (link).
4
Molecular Cloning and Cell Culture
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All reagents were purchased from Sigma, Israel unless otherwise stated. All secondary HRP-conjugated antibodies were purchased from Jackson ImmunoResearch Laboratories, USA. ECL reagent, cell culture media, and additives were from Beit-Haemek, Israel. Nitrocellulose filters were purchased from Schleicher & Schuell BioScience, USA. Annexin V and Reddot2 dye were purchased from Biotium, and G418 was purchased from Gibco. All plasmid and DNA fragment purifications were carried out with a High-Speed Plasmid Mini Kit and a ZymocleanTM Gel/PCR DNA recovery Kit (Fermentas and Zemo Research, respectively) unless otherwise specified. T4 DNA ligase and restriction enzymes were purchased from New England Biolabs, USA. DNA ligations were carried out overnight at 16°C.
5
Enzyme Assay with ABTS and Phenolics
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
2, 2′-Azino-bis (3-ethylbenzthiazoline-6-sulfonic acid) (ABTS), 2,6-dimethoxyphenol (DMP), guaiacol, toluidine, 3-aminobenzoic acid and phenyldiamine were purchased from Sigma-Aldrich (St. Louis, MO), respectively. All other chemicals and reagents were of analytical grade and were purchased from commercial sources, unless otherwise stated. Reagents for polymerase chain reaction (PCR), Ex-Taq DNA polymerase, the genomic DNA extraction kit, and the pGEM-T easy vector were purchased from Promega (Madison, WI). T4 DNA ligase and restriction enzymes were obtained from New England Biolabs (Beverly, MA). Plasmid pPICZαA and Zeocin were purchased from Invitrogen (Carlsbad, CA).
6
Cloning and Construction of NSR1 and HA-NCL Plasmids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All vectors were constructed using standard cloning procedures. T4 DNA ligase and restriction enzymes were purchased from New England Biolabs. Plasmid maintenance was carried out in TOP10 E. coli strain. The p416 (GPD) containing NSR1 gene was constructed as follows: NSR1 coding sequence was amplified from genomic DNA of the S. cerevisiae W303 WT strain using the following primers: NSR1-F 5′ CGCGGATCCATGGCTAAGACTACTAAAGTAAAAGGTAAC 3′ and NSR1-R 5′ CCGCTCGAGCGGTTAATCAAATGTTTTCTTTGAACCAG 3′. The corresponding PCR fragment was cloned into BamHI and XhoI cloning sites of p416 (GPD) centromeric vector. To introduce a HA tag in frame with human NCL, its coding sequence was PCR-amplified from cDNA extracted from HEK293T cells using HA-NCL F- 5′ CGCGGATCCATGTACCCATACGATGTTCCAGATTACGCTGTGAAGCTCGCGAAGGCAG 3′ and NCL R- 5′ CCGCTCGAGCGGCTATTCAAACTTCGTCTTCTTTCC 3′ primers and cloned into pCDNA3 vector (invitrogen) using BamHI and XhoI cloning sites. HA-NCL was then subcloned into the S. cerevisiae vector p414 (GPD). All generated constructs were amplified in the TOP10 E. coli strain, and sequenced by the Sanger method.
7
TGF-β Signaling Pathway Reconstruction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Recombinant human transforming growth factor-β (TGF-β) was purchased from R&D Systems (Minneapolis, MN, USA). T4 DNA ligase and restriction enzymes were obtained from New England Biolabs (Beverly, MA); fibronectin (FN, ≥95.0%) was purchased from Sigma-Aldrich (St. Louis, MO, USA); DAPI was purchased from Beyotime Biotechnology (Jiangsu, China); and protein A/G-agarose beads were purchased from Thermo Scientific (Rockford, IL, USA). Oligonucleotide biosynthesis was done by Generay Biotech Co., Ltd. (Shanghai, China). All the other reagents were of analytical grade and were available from commercial sources.
8
Bacillus DNA Extraction and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA from the three B. thuringiensis strains (HD-1, Bt407, and HD73) and the B. cereus strain (ATCC14579) was extracted using the Puregene Yeast/ Bact. Kit B (Qiagen, France). PCRs were performed in an Applied Biosystems 2720 Thermal cycler (Applied Biosystem, USA) with Phusion High-Fidelity or Taq DNA Polymerase (New England Biolabs, USA) and oligonucleotides (Online Resource Table 2) were synthesized by Eurofins Genomics (Germany). The QIAquick PCR Purification Kit (Qiagen, France) was used to purify the amplified DNA fragments that were subsequently treated with appropriated restriction enzymes (New England Biolabs). Digested DNA fragments were separated on 1% agarose gels and purified from gels using the QIAquick gel extraction kit (Qiagen, France). T4 DNA ligase and restriction enzymes were used following the manufacturer's recommendations (New England Biolabs). E. coli plasmid DNA extractions were performed using the QIAprep Spin Miniprep Kit (Qiagen, France). DNA sequencing was carried out by GATC Biotech (Konstanz, Germany).
9
Biocatalytic Synthesis of Chiral Compounds
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
L-phenylalanine (L-PA), trans-cinnamic acid, styrene, (S)-1-phenyl-1, 2-ethanediol, styrene oxide, 2hydroxyacetophenone (2-HAP), (±)-phenylglycinol, (R)-phenylglycinol, (S)-phenylglycinol, L-alanine (L-Ala), n-dodecane, pyridoxal-5'-phosphate (PLP) and (R)-α-methylbenzylamine (R-MBA) were from Energy Chemical and Titan Scienti c (Shanghai, China). Yeast extract, Tryptone and antibiotics (kanamycin, ampicillin and streptomycin) were from Sangon Biotech (Shanghai, China). T4 DNA ligase and restriction enzymes were from New England Biolabs (NEB, Beijing, China). Isopropyl β-D-1-thiogalactopyranoside (IPTG) and Taq plus DNA polymerase were purchased from Tsingke (Beijing, China). All other chemical reagents were obtained from commercial sources.
10
Bacterial Expression and Purification of Cra Transcriptional Regulator
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All strains and plasmids used in this study are listed in Additional file 1 . Primers are summarized in Additional file 2 . During strain construction, the strains were cultured aerobically at 37 °C in Luria broth (5 g/L yeast extract, 10 g/L tryptone, and 10 g/L NaCl). The E. coli strain DH5α was used for plasmid construction. E. coli BL21 cells were used for the expression and purification of Cra. E. coli AFP111 was kindly provided by Dr. David P. Clark at Southern Illinois University [24 (link)]. The plasmids pTrc99A and pET28a were used as foundation plasmids to prepare constructs and for overexpression. rTaq DNA polymerase and primeSTAR HS DNA polymerase were purchased from Takara (Takara, Dalian, China). Restriction enzymes and T4 DNA ligase were obtained from New England Biolabs (Ipswich, USA), while the Cycle-Pure Kit, the Gel Extraction Kit, the Bacteria RNA Kit, and the Plasmids Mini Kit were obtained from Omega (Omega Bio-Tek, Doraville, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!