Pdonr207 vector

Manufactured by Thermo Fisher Scientific

Sourced in United States

The PDONR207 vector is a laboratory tool used in molecular biology and genetic engineering applications. It is a circular DNA plasmid that serves as a cloning and expression vector. The core function of the PDONR207 vector is to facilitate the insertion, propagation, and expression of foreign DNA sequences in host cells, such as bacteria or eukaryotic cells, for research purposes.

Automatically generated - may contain errors

Lab products found in correlation

25 protocols using pdonr207 vector

Gateway Cloning of Arabidopsis MCU Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

The coding sequence of MCU3 was amplified from Arabidopsis Col-0 cDNA using primers from Supplemental Table S1 and inserted into the pDONR207 vector (Invitrogen, Carlsbad, CA, USA) using Gateway BP-Clonase II (Invitrogen) according to the manufacturer’s instructions. Gateway LR recombination was used with destination vector pUBC-GFP-Dest (Grefen et al., 2010 (link)) to generate MCU3-GFP under the control of the UBQ10 promoter. The construct was introduced into Agrobacterium tumefaciens AGL1 cells by electroporation and used for transient expression in N. benthamiana leaves (Sparkes et al., 2006 (link)).
Analogously, to generate 35S:MCU2 lines, the MCU2 coding sequence was amplified from Col-0 cDNA using primers from Supplemental Table S1 and inserted into the pDONR207 vector (Invitrogen) using Gateway BP-Clonase II (Invitrogen) according to the manufacturer’s instructions. Positive clones were confirmed by sequencing. Gateway LR recombination was used with pB7GW2 (Karimi et al., 2002 (link)) as a destination vector to place MCU2 under the control of the CaMV35S promoter. The construct was then introduced into A. tumefaciens C58C1 cells.

Ruberti C., Feitosa-Araujo E., Xu Z., Wagner S., Grenzi M., Darwish E., Lichtenauer S., Fuchs P., Parmagnani A.S., Balcerowicz D., Schoenaers S., de la Torre C., Mekkaoui K., Nunes-Nesi A., Wirtz M., Vissenberg K., Van Aken O., Hause B., Costa A, & Schwarzländer M. (2022). MCU proteins dominate in vivo mitochondrial Ca2+ uptake in Arabidopsis roots. The Plant Cell, 34(11), 4428-4452.

+ Open protocol

+ Expand

Arabidopsis Circadian Rhythm Reporter Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

The TOC1p:LUC (Col-0), LHYp:LUC (Col-0)¹⁴ and CAB2p:LUC (Col-0) seeds were provided by Dr. Robertson McClung and the toc1-101 mutant^{31 (link)} by Dr. Shu-Hsing Wu. Mutants of npr1-3^{18 (link)}, sid2^{16 (link)}, trx-h3^{19 (link)} and trx-h5^{19 (link)} were used to cross with the luciferase reporter lines. 35S:NPR1-GFP (in npr1-1)^{12 (link)} plants were used in ChIP experiment. To generate CAT3p:LUC, CAT2p:LUC homozygous lines and different T1 lines of TOC1p:LUC and TOC1p(TBSm):LUC (TOC1 promoter with mutated TGA-binding sites), wild-type CAT3, CAT2 and TOC1 promoters and mutated TOC1 promoter (amplified using QuikChange Lighting Multi Site-directed mutagenesis kit, Agilent Technologies) were cloned into the pDONR207 vector (Invitrogen) through the Gateway BP reaction (Invitrogen) and then transferred to the destination vector pGWB235^{32 (link)} through the Gateway LR recombination reaction (Invitrogen). Agrobacterium-mediated transformation of Arabidopsis was performed as previously described using wild-type plants^{33 (link)}. Homozygous T3 lines of CAT2p:LUC, CAT3p:LUC and different T1 lines of TOC1p:LUC and TOC1p(TBSm):LUC were selected and used for the luciferase imaging experiment. All primer sequences used for making the transgenic constructs are listed in Extended Data Table 1.

Zhou M., Wang W., Karapetyan S., Mwimba M., Marqués J., Buchler N.E, & Dong X. (2015). Redox rhythm reinforces the circadian clock to gate immune response. Nature, 523(7561), 472-476.

+ Open protocol

+ Expand

Generating RRES1 Complementation Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

To generate RRES1 complementation lines, the genomic sequence of RRES1 containing 2 kb promoter sequence was amplified by high-fidelity DNA polymerase (PrimeSTAR HS DNA Polymerase, Clontech). The PCR product was first introduced into pDONR207 vector (Invitrogen) by BP reaction, and then was cloned into destination vector pMDC107 vector via LR reaction. After verification of the construct by using traditional Sanger sequencing, the construct was transformed to rres1 mutants via an Agrobacterium tumefaciens-mediated floral-dip method.

Yu Z., Ren Y., Liu J., Zhu J.K, & Zhao C. (2022). A novel mitochondrial protein is required for cell wall integrity, auxin accumulation and root elongation in Arabidopsis under salt stress. Stress Biology, 2(1), 13.

+ Open protocol

+ Expand

Subcellular Localization of PARP1 and PARP2

Check if the same lab product or an alternative is used in the 5 most similar protocols

The full-length cDNAs of PARP1/2 and PARG1/2 were subcloned into the pDONR 207 vector (Invitrogen) and introduced into the destination vector pGWB405, resulting in constructs with C-terminal fusions to GFP under the control of 35S promoter. The sequence-verified constructs were transformed into Agrobacterium tumefaciens strain GV3101(pMP90) and transiently expressed in Nicotiana benthamiana leaves by infiltration. Confocal fluorescence microscopy was carried out at indicated times using a Zeiss 510 Meta confocal laser scanning microscope. Agrobacterium strains carrying 35S:PARP1-GFP and 35S:PARP2-GFP were also used to transform wild-type Col-0 Arabidopsis by floral dip [80 (link)]. Stable transgenic T2 lines were selected and the subcellular locations of PARP1 and PARP2 were examined by confocal microscopy.

Song J., Keppler B.D., Wise R.R, & Bent A.F. (2015). PARP2 Is the Predominant Poly(ADP-Ribose) Polymerase in Arabidopsis DNA Damage and Immune Responses. PLoS Genetics, 11(5), e1005200.

+ Open protocol

+ Expand

Conserved RRSVs gp1 Gene Silencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Sequences from RRSVs6gp1 (AF020337), RRSVs9gp1 (GQ329711), and RRSVs10gp1 (U66712) were used to choose conserved 150-nt fragments. First, a BLAST search was performed to evaluate the nucleotide diversity among related sequences. Due to high conservation, 150-nt fragments were randomly chosen in each of the three genes. These fragments (450-nt tandem) were de novo synthetized in a pUC18 vector by Genecust Company (Boynes, France) with att recombination sites for further gateway cloning (Luxembourg). Then, the tandem sequence was first inserted in the gateway cassette of a pDONR207 vector at the BP recombinase site (Invitrogen, Carlsbad, CA, USA). Then, using LR recombinase (Invitrogen), the tandem sequence was transferred into the two gateway cassettes of the pANDA vector in sense and antisense orientations [53 (link)]. The resulting construct, specifically pANDA:siRRSV, was transformed into Agrobacterium strain EHA105 by electroporation.

Lacombe S., Bangratz M., Ta H.A., Nguyen T.D., Gantet P, & Brugidou C. (2021). Optimized RNA-Silencing Strategies for Rice Ragged Stunt Virus Resistance in Rice. Plants, 10(10), 2008.

+ Open protocol

+ Expand

Generating amiRNA Targeting PECT1 in Arabidopsis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The amiRNA targeting PECT1 (At2g38670) was designed with the WMD2 software and following the instructions available at the web site: http://wmd2.weigelworld.org/cgi-bin/mirnatools.pl. miRNA (ACCCCGTATTCTCTACCAATA) and miRNA* (TATTGGTACAGAATACGGGTT) were cloned by PCR into the Arabidopsis precursor MIR319a included in the vector pRS300. The amiRNA precursor fragment was then amplified by using primers containing Gateway sites (F206 and F207) and subcloned by RB reaction in a pDONR207 vector (Invitrogen). LR recombination was performed to transfer the amiRNA precursor fragment to the binary vectors pSUC2::GW2 (link) and pFD::GW to generate the pSUC2::amiPECT1 and pFD::amiPECT1 constructs, respectively. pFD::GW was generated from the vector pLEELA27 (link) in which the 2 × 35S promoter was replaced at the AscI/XhoI restriction sites by 2.8 Kbs of the FD promoter. The CDS of PECT1 was amplified with the primers PECT1_gw_F and PECT1_gw_R and cloned by LR recombination into pFD::GW to generate pFD::PECT1. Plants were transformed with Agrobacterium tumefaciens strain GV3101 pMP90 RK by floral dipping28 (link). The primer sequences used for cloning are listed in the Supplementary Table 2.

Nakamura Y., Andrés F., Kanehara K., Liu Y.C., Dörmann P, & Coupland G. (2014). Arabidopsis florigen FT binds to diurnally oscillating phospholipids that accelerate flowering. Nature Communications, 5, 3553.

+ Open protocol

+ Expand

Generating Transgenic Arabidopsis Plants

Check if the same lab product or an alternative is used in the 5 most similar protocols

To construct LDL/FLD::GFP-GUS transgenic Arabidopsis plants, 2- to 3-kb promoter regions including the 5′UTR were amplified from Arabidopsis genomic DNA by PCR and cloned into the pDONR207 vector (Invitrogen) via Gateway Technology (Invitrogen). Sequences of oligonucleotides used for the amplification of promoter regions are shown in Supplementary Table 2. Following sequencing, promoter regions were inserted into the Gateway binary vector pKGWFS7 vector (Karimi et al., 2002 (link)) in-frame with the downstream green fluorescent protein (GFP) and β-glucuronidase (GUS) reporter genes. The resulting constructs were used to transform A. thaliana wild-type plants by the Agrobacterium tumefaciens-mediated floral dip transformation method (Bent, 2006 (link)). Independently transformed plant lines were tested by PCR.

Martignago D., Bernardini B., Polticelli F., Salvi D., Cona A., Angelini R, & Tavladoraki P. (2019). The Four FAD-Dependent Histone Demethylases of Arabidopsis Are Differently Involved in the Control of Flowering Time. Frontiers in Plant Science, 10, 669.

+ Open protocol

+ Expand

Amplification and Cloning of Fungal SSPs

Check if the same lab product or an alternative is used in the 5 most similar protocols

The full-length of TaSRTRG6, TaSRTRG7 and twenty-seven Z. tritici candidate SSPs (Karki, unpublished) were amplified from the first strand cDNA synthesized form total RNA derived from a Z. tritici isolate IPO560 or Cork Cordiale 4 infected wheat leaf (cv. Stigg). The specific primers with attB1 and attB2 sites were used in amplification. Gateway PCR products flanked by the attB1 and attB2 sites were recombined into the pDONR 207 vector (Invitrogen, United States) to create the corresponding entry clones with attL1 and attL2 sites following the manufacturer’s protocol. The relevant entry clones (pENTR) were subsequently recombined into appropriate destination vectors via an LR reaction to create the expression constructs. All primers used are shown in Supplementary Table S1.

Brennan C.J., Zhou B., Benbow H.R., Ajaz S., Karki S.J., Hehir J.G., O’Driscoll A., Feechan A., Mullins E, & Doohan F.M. (2020). Taxonomically Restricted Wheat Genes Interact With Small Secreted Fungal Proteins and Enhance Resistance to Septoria Tritici Blotch Disease. Frontiers in Plant Science, 11, 433.

+ Open protocol

+ Expand

Cloning and Sequencing of Target Gene

Check if the same lab product or an alternative is used in the 5 most similar protocols

The fragment corresponding to the same region used for CAPS analysis that was amplified using the primers 5'–CCTGTTGGGCCCATGAGTACAGGGAGTTCTACATTGC–3' and 5'–ATGGCCGAATTCGCAGTCCTCCCAAGCCAAGTTTG–3' was treated with KpnI. Then, the resultant fragments were inserted into the pDONR207 vector (Invitrogen, Carlsbad, USA) after digestion with ApaI and EcoRI. The plasmids obtained were used for nucleotide sequence analysis.

Onodera H., Shingu S., Ohnuma M., Horie T., Kihira M., Kusano H., Teramura H, & Shimada H. (2018). Establishment of a conditional TALEN system using the translational enhancer dMac3 and an inducible promoter activated by glucocorticoid treatment to increase the frequency of targeted mutagenesis in plants. PLoS ONE, 13(12), e0208959.

+ Open protocol

+ Expand

Generation of Inducible OsRKD3 Rice Vector

Check if the same lab product or an alternative is used in the 5 most similar protocols

For generation of the inducible-OsRKD3 vector, we designed full-length CDS of OsRKD3 (synOsRKD3), codon-optimized for rice and chemically synthesized (IDT, Leuven, BE) (Table S11). The synthesised synOsRKD3 was introduced into a pDONR207 vector (Invitrogen, USA) via BP recombination and subcloned by LR recombination in the two-component chemically inducible vector pTA7002 [31 (link)]. The pTA7002-synOsRKD3 vector, thereafter named indOsRKD3, was fully sequenced and the construct was introduced into Agrobacterium tumefaciens EHA105. Rice transformation was performed by the Agrobacterium-mediated co-cultivation method and culture media as previously described [63 (link)–65 (link)].

Purwestri Y.A., Lee Y.S., Meehan C., Mose W., Susanto F.A., Wijayanti P., Fauzia A.N., Nuringtyas T.R., Hussain N., Putra H.L, & Gutierrez-Marcos J. (2023). RWP-RK Domain 3 (OsRKD3) induces somatic embryogenesis in black rice. BMC Plant Biology, 23, 202.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!