HEK293T cells (ATCC CRL-3216) were cultured in Dulbecco’s modified Eagle’s medium DMEM (Dibco) supplemented with 10% HI-FBS and 1% Pen-strep at 37 °C and 5% CO2. For transfections, cells were grown in six-well plates to a confluence of 70% and then transfected using X-tremeGENE (Sigma-Aldrich) according to the manufacturer’s protocol (1 μg of plasmid, 3 μL of X-tremeGENE, and Opti-MEM to a final volume of 200 μL). Cells were allowed to grow at 37 °C for an additional 16–24 h, trypsinized and washed with PBS, and then analyzed. Readthrough activity was quantified by measurement of EGFP and mCherry fluorescence signals and comparison to cells transfected with the full-length EGFP-mCherry fusion plasmid. Reporter validation was performed by transfecting different ratios of the full-length EGFP-mCherry fusion plasmid and the inactive control plasmid.
X tremegene
Manufactured by Merck Group
Sourced in United States
X-tremeGENE is a transfection reagent that facilitates the introduction of nucleic acids, such as DNA or RNA, into a variety of cell types. It is designed to efficiently deliver these molecules into the cells, enabling researchers to study gene expression, protein function, and other cellular processes.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine rnaimax, by Thermo Fisher Scientific (3 mentions)
Opti mem media, by Thermo Fisher Scientific (3 mentions)
4 6 diamidino 2 phenylindole (dapi), by Thermo Fisher Scientific (2 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions)
Opti mem, by Thermo Fisher Scientific (2 mentions)
Sybr green master mix, by Thermo Fisher Scientific (2 mentions)
Pcdna3, by Thermo Fisher Scientific (1 mentions)
Rnaimax, by Thermo Fisher Scientific (1 mentions)
Mirna inhibitor, by GenePharma (1 mentions)
Pspax2, by Addgene (1 mentions)
Pmd2 g, by Addgene (1 mentions)
Formaldehyde, by Merck Group (1 mentions)
Anti myc mab, by Santa Cruz Biotechnology (1 mentions)
Cloning cylinder, by Merck Group (1 mentions)
Hek293 cell, by Thermo Fisher Scientific (1 mentions)
Fetal calf serum (fcs), by Merck Group (1 mentions)
Penicillin streptomycine, by Merck Group (1 mentions)
Dmem f12 medium, by Thermo Fisher Scientific (1 mentions)
L glutamine, by Merck Group (1 mentions)
Non targeting sirna pool, by Horizon Discovery (1 mentions)
35 protocols using x tremegene
1
Measuring Readthrough Activity in HEK293T Cells
2
CRISPR-mediated Silencing of Kitl in 4T1 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CRISPR guide RNAs (sgRNA) were designed to target the SCF gene kitl located on chromosome 10 of the mouse genome using the sgRNA scorer 2.0 and candidates were selected based on their high predicted activity and lack of off-target effects. Selected sgRNA were cloned into pX458 cloning vector containing a Cas9-2A-GFP by ligating two annealed oligos following digestion with Bbsl restriction enzyme. 4T1 cell lines were transfected by CRISPR plasmid using x-tremeGENE (Sigma-Aldrich) transfection reagent at a ratio of 3:1 (90 μl x-tremeGENE : 30 μg of plasmid) in 1000 μl of serum free Optimem and incubated for 15 min at room temperature. Transfection suspension was added to 10 ml of RPMI and added directly to cells. Following transfection, GFP+ 4T1 cells were found to be typically 4% of total cells and were purified by fluorescent associated cell sorting and placed in single cell cultures. Cultures were first screened for SCF production using ELISA (Sigma-Aldrich), selected candidates had editing efficiencies confirmed by Illumina Miseq sequencing for non-homogenous end joining (NHEJ) induced mutation rates. CRISPR silenced 4T1 cell lines were compared to 4T1 transfected cell lines which failed to silence kitl gene.
3
Overexpression of TRIM36 in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human TRIM36 cDNA was amplified by PCR. The generated amplicon was subcloned into pCDNA3 (Invitrogen, St. Louis, MO, USA) with an N‐terminal His tag to generate mammalian expression plasmid. Cells were cultured in 6‐well plates 24 hours before transfection. Transfection of expression vector containing TRIM36 cDNA or empty vector (control) was carried out using X‐tremeGENE (Sigma Aldrich Japan), according to the manufacturer's protocol. The cell extracts were analyzed after 72 hours by western blotting.
4
Modulating HSPD1 and E-cadherin in Oral Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Oral cancer cells were seeded into 6-well plates then transfected with the pCGN-HA vector containing full-length cDNA of human HSPD1 or with the GFP-tagged E-cadherin expression vector using X-tremeGENE (Sigma-Aldrich Corporation, St. Louis, MO, USA) for 24 h. For transient knockdown, cells were transfected with 5 nM scrambled siRNA or siRNA against HSPD1, RelA, β-catenin, and E-cadherin (Ambion, Foster City, CA, USA) using RNAiMAX (Life technologies, Carlsbad, CA, USA) for 48 h.
5
Lentiviral Delivery of siRNA, miRNA, and Overexpression Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were transfected with small interfering RNAs (siRNAs), miRNA mimics, or miRNA inhibitor (GenePharma, China) using Lipofectamine RNAiMAX (Invitrogen, USA). The circPICALM sequence was cloned into the pLenti-ciR-GFP-T2A-puro vector (IGEbio, China), and the STEAP4 sequence was cloned into the pCDH-GFP + Puro-3xFLAG vector (IGEbio, China). To package lentivirus, HEK-293 T cells were transfected with overexpression vectors, psPAX2 (Addgene, USA, RRID:Addgene_12260) and PMD2.G (Addgene, USA, RRID:Addgene_12259) using X-tremeGENE (Sigma, USA). Lentiviruses were harvested, filtered and concentrated. Cells were infected with virus and selected with puromycin. The oligonucleotides transfected in this study are listed in Supplementary Table 3 .
6
Detecting Tsg101 Colocalization in Transfected HeLa Cells
7
Generation of ATG7 Knockout Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human embryonic lung fibroblasts WI26/SV-40 were used to generate stable ATG7 knock-out clones. Two independent clones (three and seven) were generated using the CRISPR/Cas9 system74 (link). In brief, double-stranded DNA oligonucleotides that encode guide RNAs (gRNAs) against ATG7 were cloned into the BbsI restriction sites of the pX459 vector. The gRNA oligonucleotides sequences used for the generation of the ATG7 KO lines were:
hATG7-gRNA-ex3-s 5’ caccgAACTCCAATGTTAAGCGAGC 3’
hATG7-gRNA-ex3-as 5’ aaacGCTCGCTTAACATTGGAGTTc 3’
Cells were transfected with the resulting vectors using XtremeGENE HP (Sigma Aldrich) according to the manufacturer’s protocol and selected with puromycin (2 µg/ml) for 5 days. Single cell clones were picked using cloning cylinders (Sigma-Aldrich), clones deficient for the targeted protein were identified by immunoblot and knock-out clones were validated by genomic DNA sequencing using the following primers: hATG7-in2-s: 5’ CCTGGCTGAGTCCCAGCTGTG 3’ hATG7-in3-as: 5’ GAAGACACTGCAGAGACTAC 3’. The respective control cell line was generated by using the empty vector and following the same procedure described above for the knockout cell lines.
hATG7-gRNA-ex3-s 5’ caccgAACTCCAATGTTAAGCGAGC 3’
hATG7-gRNA-ex3-as 5’ aaacGCTCGCTTAACATTGGAGTTc 3’
Cells were transfected with the resulting vectors using XtremeGENE HP (Sigma Aldrich) according to the manufacturer’s protocol and selected with puromycin (2 µg/ml) for 5 days. Single cell clones were picked using cloning cylinders (Sigma-Aldrich), clones deficient for the targeted protein were identified by immunoblot and knock-out clones were validated by genomic DNA sequencing using the following primers: hATG7-in2-s: 5’ CCTGGCTGAGTCCCAGCTGTG 3’ hATG7-in3-as: 5’ GAAGACACTGCAGAGACTAC 3’. The respective control cell line was generated by using the empty vector and following the same procedure described above for the knockout cell lines.
8
Establishing NTCP/Ntcp-expressing Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
GripTite 293 MSR cells (further referred to as HEK293 cells, Invitrogen), a modified HEK293 cell line expressing human macrophage scavenger receptor for stronger adhesion, were maintained at 37°C, 5% CO2 and 95% humidity in DMEM/F-12 medium (Thermo Fisher Scientific) supplemented with 10% fetal calf serum (Sigma), 4 mM L-glutamine (PAA) and penicillin/streptomycine (PAA). HepG2 cells (Clontech) were cultivated under the same conditions in DMEM medium with all supplements listed above, except for L-glutamine. HEK293 cells were transiently transfected with human NTCP and monkey Ntcp constructs for all transport and peptide binding assays. Transfection was performed with Lipofectamine 2000 (Thermo Fisher Scientific). NTCP/Ntcp-transfected HepG2 cells were used for all HBV/HDV infection experiments as reported before [4 (link)]. They were transfected using X-tremeGENE (Sigma-Aldrich).
9
Modulating EP300, SIRT1 and SIRT6 in BT474 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
BT474 and BT474-LapR cell lines were seeded to achieve approximately 60–70% confluency in T75 flasks before transfection. The plasmid-encoding human EP300, pcDNA3.1-EP300, the acetyl-transferase mutant, pcDNA3.1-p300 (HAT-) and the empty vector were transfected into cells using XtremeGene (Sigma-Aldrich). Transfection was performed at a 3:1 XtremeGene: DNA ratio using 8 µg of plasmid following manufacturer’s instruction. Transfected cells were counted and used for any subsequent assays 24 h post-transfection. For gene silencing, cells were plated in at 60–70% densities. The following day, cells were transfected with ON-TARGET plus siRNAs (GE Dharmacon, Horizon Discovery LTD, Cambridge, United Kingdom) targeting EP300 (L-003486-00-0005), SIRT1 (L-003540-00-0005) or SIRT6 (L-013306-00-0005) using oligofectamine (Invitrogen, Thermo Fisher Scientific, UK) according to the manufacturer’s protocol. Non-Targeting siRNA pool (GE Dharmacon; D-001210-01-05) was used as transfection control.
10
Generating Lentiviral Pseudo-particles for NTCP Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentiviral pseudo-particles were generated by co-transfecting 4.0E + 6 293T cells in a 10 cm tissue-culture plate using Xtremegene (Sigma-Aldrich, St. Louis, MO) with plasmids expressing the respective pLVX-NTCP-tagRFP proviral DNA, HIV-1 gag–pol, and VSV-G at a ratio of 1/0.8/0.2. Supernatants were collected at 24, 48 and 72 h, pooled, and filtered through a 0.45 μm filter (Millipore, Burlington, MA). Filtered lentiviral supernatants were supplemented with polybrene (4 μg/mL, vol/vol) and (1:50, vol/vol) 1 M HEPES, aliquoted, and stored at −80 °C until use. Next, HepG2 cells were transduced with the human-, OWM- (with or without humanizing mutations), NWM- (with or without humanizing mutations), or prosimian-NTCP-tagRFP lentiviruses. After 3 days, expression of the fusion protein was assessed by both fluorescence microscopy using an EVOS microscope (Fisher Scientific, Waltham, MA) and LSRII Multi-Laser Analyzer (BD, Franklin Lakes, NJ) at the Princeton flow cytometry core facility. Each cell line generated showed greater than 90% of the cells expressing the respective fusion construct.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!