Imiquimod r837

Groups of five C57BL/6, TLR4^−/− and MyD88^−/− mice (both on C57BL/6 background), two to four months of age, were injected i.p. with LPS at 5 mg/kg body weight dosage (E. coli O55:B5, Sigma, St. Louis, MO, USA) dissolved in endotoxin free PBS. Blood was collected at different times before and after injection and serum was stored at −80 °C until use. Polyreactive antibodies against different antigens and total Igs were measured by ELISA. Phosphorothioate CpG oligonucleotide 5′-GAGAACGCTCGACCTTCCAT-3′ and control oligonucleotide 5′-GAGAAGCCTGCACCTTCCAT-3′ were synthesized at the Core Facility of Center for Biological Evaluation and Research, Food and Drug Administration, Bethesda, USA and injected i.p at a dose of 500 μg per mouse. Imiquimod (R837) and PolyI:C (In Vivogen, San Diego, CA, USA) were dissolved in sterile endotoxin free PBS and injected i.p at a dose of 250 and 100 μg/mouse, respectively. Polyreactive antibody at the indicated time points was measured by ELISA.

The trimer gp140 was diluted in saline and emulsified/mixed with the following adjuvants: i) 1 mg Monophosphoryl Lipid A (InvivoGen), ii) Complete/ Incomplete Freund’s adjuvant (CFA/IFA, Sigma) according to manufacturer specifications, iii) 50 μg polyinosine-polycytidyl IC- poly (I:C) (InvivoGen), iv) 20 μg Imiquimod- R837 (InvivoGen), v) 20 μg Resiquimod- R848 (InvivoGen), vi) 10 μg Muramyl dipeptide (MDP)- (InvivoGen), vii) 1mg aluminiun hydroxide gel (Sigma), viii) 20 μg Ribi (Sigma) and ix) 10 μg CpG ODN 1826 (TCCATGACGTTCCTGACGTT) synthesized with a nuclease-resistant phosphorothioate backbone (InvivoGen). In animals that received the first dose with Complete Freund’s adjuvant (CFA, Sigma), the booster injections were provided with antigen emulsified in IFA. The control groups received the adjuvant alone or the recombinant protein diluted in PBS.

The TLR2 ligand ultrapure E. coli 0111:B4 peptidoglycan (PGN-EB), the TLR3 ligand synthetic analogue of dsRNA poly (I:C) with a high molecular weight, the TLR4 ligand ultrapure E. coli 0111:B4 lipopolysaccharide (LPS-EB) and the TLR7 ligand small synthetic antiviral molecule Imiquimod (R837) were all from InvivoGen.

PBMCs were counted and resuspended in Dutch modified Roswell Park Memorial Institute (RPMI) medium (Life Technologies), supplemented with 50 µg/mL gentamicin (Thermo Fisher Scientific), 1 mM sodium pyruvate (Thermo Fisher Scientific), and 2 mM Glutamax (Thermo Fisher Scientific). 5 x 10⁵ PBMCs were cultured in a final volume of 200 μL/well in round bottom 96-well plates (Greiner Bio-one) and stimulated with of heat-inactivated SARS-CoV-2 Wuhan-Hu-1 virus variant (1.19 x 10⁴ TCID50/ml; NRW-42 isolate, kindly provided by Heiner Schaal, University Hospital Düsseldorf, Germany) (17 (link)), heat-inactivated Staphylococcus aureus (1 x 10⁶ CFU/mL; clinical isolate), heat-inactivated influenza virus H1N1 (3.2 x 10⁵ K/mL, kindly provided by Ortwin Adams, University Hospital Düsseldorf, Germany), Imiquimod/R837 (10 µg/ml; InvivoGen), Poly (I:C) (10 µg/mL; InvivoGen), R848 (10 µg/mL; InvivoGen), purified lipopolysaccharide (LPS) derived from Escherichia coli O55:B5 (10 ng/mL; Sigma-Aldrich), or recombinant human interleukin-1 alpha (IL-1α) (10 ng/mL; R&D Systems), in the presence of dexamethasone (10 nM or otherwise stated; Sigma-Aldrich) or vehicle control (dimethyl sulfoxide; DMSO). After 4h cells were lysed in RLT buffer (Qiagen) and stored at −80°C for subsequent RNA isolation. After 24 h or 7 days, supernatants were collected and stored at –80°C until analysis.

miR-146a-5p and miR-146a-5p_{U → A} mutant were synthesized by Integrated DNA Technologies (Coralville, IA). Imiquimod (R837) was purchased from InvivoGen (San Diego, CA). Lipofectamine 3000 was from Thermo Fisher Scientific (Waltham, MA). LPS, collagenases B and D, gelatin, and pancreatin were from Sigma-Aldrich (St. Louis, MO). Laminin was from Roche Diagnostics (Basel, Switzerland). Collagenase 2 was acquired from Worthington Biochemical, (Lakewood Township, NJ). Phthalo blue was acquired from Liquitek (Cincinnati, OH).

Imiquimod (R837) was from InvivoGen. LPS (Escherichia coli type), anti-FLAG, PMA, anti-mouse agarose, anti-HA (clone HA-7) agarose, anti-FLAG (M2) agarose, HA peptide, and 3×FLAG peptide were from Sigma-Aldrich. Monoclonal anti-HA 3F10 and complete protease inhibitor tablets were from Roche. Anti-human CD107A (Lamp1) was from AbD Serotec. Anti-calnexin C-20 was from Santa Cruz Biotechnology, and anti-EEA1 was from Cell Signaling Technology. Anti-rat HRP, anti-mouse HRP, and anti-goat HRP were from R&D Systems, and anti-IL-8–allophycocyanin was from BD Pharmingen. Anti-rabbit Alexa Fluor 555, anti-mouse Alexa Fluor 647, and streptavidin-coated Dynabeads were from Invitrogen. Goat anti-mouse Abberior STAR 440SX-conjugated Ab was a kind gift from Christian Eggeling (University of Oxford). For hIL-8 ELISA, purified anti–hIL-8, monoclonal (clone G265-5; #554716) and biotinylated anti–hIL-8, monoclonal (#554718) were used. The cell surface biotinylation kit was from Pierce Thermo Scientific. The QuikChange II XL Site-Directed Mutagenesis Kit was from Agilent Technologies.