Cyclin t1

Manufactured by Santa Cruz Biotechnology

Sourced in United States

Cyclin T1 is a protein that functions as a regulatory subunit of the positive transcription elongation factor b (P-TEFb) complex. It plays a crucial role in the regulation of transcriptional elongation by RNA polymerase II.

Automatically generated - may contain errors

Lab products found in correlation

Hsp90, by Santa Cruz Biotechnology (2 mentions) Cyclin k, by Santa Cruz Biotechnology (2 mentions) Lsrfortessa cell analyzer, by BD (1 mentions) Nf κb p65, by Santa Cruz Biotechnology (1 mentions) Pcdk9, by Cell Signaling Technology (1 mentions) Phospho nf κb p65, by Cell Signaling Technology (1 mentions) β actin, by Merck Group (1 mentions) Rnapii, by Merck Group (1 mentions) Srsf1, by Santa Cruz Biotechnology (1 mentions) Western lightning plus ecl reagent, by PerkinElmer (1 mentions) Ph3 ser10, by Merck Group (1 mentions) Foxa1, by Abcam (1 mentions) P rna pol 2 ser5, by Abcam (1 mentions) Histone 3, by Abcam (1 mentions) Anti flag m2 affinity gel, by Merck Group (1 mentions) Flag m2, by Merck Group (1 mentions) Gapdh, by Abcam (1 mentions) β actin, by Abcam (1 mentions) H3k27ac, by Abcam (1 mentions) β tubulin, by Merck Group (1 mentions)

7 protocols using cyclin t1

Evaluating SCFA-Induced HIV-1 Transactivation

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

To determine the efficiency of SCFAs in inducing HIV-1 transactivation, HIV-1 latently infected Jurkat T-cell line 2D10 was stimulated with various doses of SCFAs or bacterial supernatants at different dilutions. The cells were then washed in Auto-MACs running buffer and the numbers of cells with d2EGFP expression were determined by flow cytomerty (BD LSRFortessa cell analyzer) analysis.
To measure HIV-1 transactivation in primary T-cells that were latently infected with HIV-1, following stimulation with bacterial supernatants or SCFAs, the cells were stained for HIV-1 Nef protein expression by using an AF647 conjugated antibody to Nef protein (AIDS Reagents, Item#709), an AF750 conjugated antibody to phosphorylated pTEF-b (pS175) (Mbonye et al., 2013 (link)), and a TRITC-conjugated antibody to Cyclin T1 (Santa Cruz Biotechnology, Inc), followed by flow cytometry quantification of Nef-positive, pS175-positive, and Cyclin T1-positive cells.

Das B., Dobrowolski C., Shahir A.M., Feng Z., Yu X., Sha J., Bissada N.F., Weinberg A., Karn J, & Ye F. (2014). Short Chain Fatty Acids Potently Induce Latent HIV-1 in T-cells by Activating P-TEFb and Multiple Histone Modifications. Virology, 474, 65-81.

+ Open protocol

+ Expand

Multiparameter Immune Cell Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Antisera used are: CD25 (catalog no. 12-0259-42, eBioscience), CD69 (catalog no. 11-0699-41, eBioscience), PARP (Catalog no. 95425, Cell Signaling), Cyclin T1 (catalog no. sc-10750, Santa Cruz Biotechnology), β-actin (catalog no. sa135600204; Sigma), phospho NF-κB p65, (Ser536, catalog no. 3033S, Cell Signaling), pCDK9 (Thre186, catalog no. 2549, Cell Signaling), Hsp90 (catalog. no. sc-69703, Santa Cruz Biotechnology), NF-κB p65 (catalog. no. sc-109, Santa Cruz, Biotechnology), CDK9 (catalog no. sc-484, Santa Cruz Biotechnology).

Liu H., Hu P.W., Dubrulle J., Stossi F., Nikolai B.C., Mancini M.A, & Rice A.P. (2021). Identification of celastrol as a novel HIV-1 latency reversal agent by an image-based screen. PLoS ONE, 16(4), e0244771.

+ Open protocol

+ Expand

ChIP-qPCR analysis of HIV-1 transcription

Check if the same lab product or an alternative is used in the 5 most similar protocols

HEK293 cells transfected with the indicated plasmids. At 48 h post-transfection cells were cross-linked in 1% formaldehyde and ChIP was performed as previously described (22 (link)) utilizing the following antibodies RNAPII (Millipore, clone CTD4H8), RNAPII Phospho Ser2 (AbCam, #ab24758), GFP (Santa Cruz Biotechnology, #sc-9996), SRSF1, Cyclin T1 (Santa Cruz Biotechnology, sc-10750) or normal rabbit immunoglobulin G (IgG) (Cell Signaling Technologies, #2729). The green fluorescent protein (GFP) antibody was utilized to precipitate the product of the pTat-GFP construct. The data collected were derived from three independent experiments and quantified by qPCR assays carried out with primer pairs specific for the LTR promoter (TAR_Fb: GGAACCCACTGCTTAAGCCT; TAR_Rb: GGATCTCTAGTTACCAGAGT) and the open reading frame (ORF) (RF21.21: TTCTTCAGAGCAGACCAGAGC; RF20.22: GCTGCCAAAGAGTGATCTGA) utilizing a Stratagene Mx3005P and analyzed with MxPro V3.0 software. The data sets were normalized to input values and results expressed as fold enrichment over the IgG control. Data are represented as means ± SEM.

Paz S., Krainer A.R, & Caputi M. (2014). HIV-1 transcription is regulated by splicing factor SRSF1. Nucleic Acids Research, 42(22), 13812-13823.

+ Open protocol

+ Expand

Antibody Sources for AR and Associated Factors

Check if the same lab product or an alternative is used in the 5 most similar protocols

The sources for the antibodies and control IgGs were as following: AR (Santa Cruz, Cat. sc-816); pAR-S81 (EMD Millipore, Cat. 07–1375); pAR-S308 (Santa Cruz, Cat. sc-26406); pRNA Pol II Ser2 (Abcam, Cat., ab5095); pRNA Pol II Ser5 (Abcam, Cat. ab5131); CDK1 (Cell Signaling, Cat. 9112); pCDK1-T161 (Cell Signaling, Cat. 9114); CDK9 (Santa Cruz, Cat. sc-8338); Cyclin T1 (Santa Cruz, Cat. sc-10750); BRD4 (Bethyl, Cat. A301-985A); p300 (Santa Cruz, Cat. sc-585); Histone 3 (Abcam, Cat. ab1791); H3K27Ac (Abcam, Cat. ab4729); pH3-Ser10 (EMD Millipore, Cat. 06–570); FoxA1 (Abcam, Cat. Ab23738); PSA (Meridian Life Science, Cat. K92110R); Flag-M2 (Sigma-Aldrich, Cat. F3165); HA (Cell Signaling, Cat. 3724); β-Tubulin (EMD Millipore, Cat. MAB3408); β-Actin (Abcam, Cat. Ab6276); GAPDH (Abcam, Cat. Ab9485); Hsp90 (Santa Cruz, Cat. sc-69703), PP1 (Santa Cruz: Cat. sc-443; Cat. sc-6104; and Cat. sc-6105), and control IgGs (Santa Cruz: normal rabbit IgG, Cat. sc-2027; and normal goal IgG, Cat. sc-2028). Protein A and protein G was from Pierce (Cat. 20334 and Cat. 20399, respectively). The anti-flag M2 affinity gel was from Sigma-Aldrich (Cat. A2220). Western blots were developed using X-Ray film (Research Products International) and the Western Lightning Plus-ECL reagent (PerkinElmer). Images were acquired using a CanoScan LiDE 210 scanner.

Liu X., Gao Y., Ye H., Gerrin S., Ma F., Wu Y., Zhang T., Russo J., Cai C., Yuan X., Liu J., Chen S, & Balk S.P. (2017). Positive feedback loop mediated by protein phosphatase 1α mobilization of P-TEFb and basal CDK1 drives androgen receptor in prostate cancer. Nucleic Acids Research, 45(7), 3738-3751.

+ Open protocol

+ Expand

ChIP Assay for UHRF1 Targeting HIV-1 LTR

Check if the same lab product or an alternative is used in the 5 most similar protocols

ChIP experiments were performed according to the manufacturer’s instructions (Millipore). Briefly, TZM-bl or U1 cells with UHRF1 knockdown were used. In some tests, cells were further infected with the HIV-1_NL4-3 virus. Cells were cross-linked with 1% formaldehyde for 10 min at room temperature and quenched with 125 mM glycine for 5 min. After washing three times, the cells were lysed and chromatin was sheared by use of a sonicator for a total of 12 rounds (40 output and 10 s/round) to obtain DNA fragments of 200 to 400 bp. One percent of the total sheared chromatin DNA was used as the input sample. Other sheared chromatin was incubated overnight at 4°C with an antibody against UHRF1 (Santa Cruz), cyclin T1 (Santa Cruz), pSer-2 RNA Pol II (CST), or mouse IgG (Proteintech), followed by incubation with 60 μl of protein G agarose beads for 6 h. After washing and reversing cross-linking, the input and immunoprecipitated DNA was purified and analyzed by real-time PCR using primers specifically targeting the HIV-1 LTR.

Liang T., Zhang Q., Wu Z., Chen P., Huang Y., Liu S, & Li L. (2021). UHRF1 Suppresses HIV-1 Transcription and Promotes HIV-1 Latency by Competing with p-TEFb for Ubiquitination-Proteasomal Degradation of Tat. mBio, 12(4), e01625-21.

+ Open protocol

+ Expand

Immunoblotting of Cell Signaling Proteins

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Samples from whole-cell lysates were prepared, and 30 μg of protein per condition were subjected to immunoblotting analysis as previously described [53 (link)]. Where indicated, the blots were re-probed with antibodies against β-actin, α-tubulin or GAPDH (EMD/Millipore/Sigma, Billerica, MA, USA) to ensure equal loading and transfer of proteins. Primary antibodies included: Caspase 3, Mcl-1 (BD-Pharmingen, San Diego, CA, USA); caspase 9, cleaved caspase 3 (Asp175), cleaved caspase 9 (Asp315), Bcl-xL, cleaved PARP (Asp214) and p-CDK9 (T186) (Cell Signaling, Beverly, MA, USA); RNA Polymerase II (EMD/Millipore/Sigma, Billerica, MA, USA), RNA Polymerase II (H5) (the phosphoserine 5 form of pol II), and RNA Polymerase II (H14) (the phosphoserine 2 form of pol II) (BioLegend, Dedham, MA, USA); human Bcl-2 oncoprotein (DAKO, Carpinteria, CA, USA); PARP (Enzo, Plymouth Meeting, PA, USA); CDK9, cyclin T1, cyclinT2a/b, cyclin K, and XBP-1 (Santa Cruz Biotech, Santa Cruz, CA, USA).

Zhang Y., Zhou L., Leng Y., Dai Y., Orlowski R.Z, & Grant S. (2017). Positive transcription elongation factor b (P-TEFb) is a therapeutic target in human multiple myeloma. Oncotarget, 8(35), 59476-59491.

+ Open protocol

+ Expand

Comprehensive Western Blot Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were lysed in lysis buffer (100 mM Tris, pH 7.4, 1% sodium dodecyl sulfate (SDS), 10% glycerol), sonicated, and protein concentrations were assessed by the bicinchoninic acid (BCA) assay. Laemmli buffer (3×) was then added, and lysates were boiled for 5 min at 100°C. Cell lysates were separated with electrophoresis employing 8%-15% gels and then wet blotted to a nitrocellulose membrane (GE Healthcare, Amersham, #10600008, Little Chalfont, UK). Individual proteins were detected with specific antibodies: BRCA1 (Santa Cruz, sc-6954), CDK12 (Cell Signaling, #11973, Danvers, MA, USA), CDK13 (rabbit serum produced in-house), Cyclin K (Santa Cruz, sc-376371), p53 Pantropic Ab-6 (Millipore, OP43, Billerica, MA, USA), Cyclin T1 (Santa Cruz, sc-8127), CHK1 (Cell Signaling, #2360), CHK1-pSer296 (Cell Signaling, #2349), PARP (Cell Signaling, #9542), γH2AX pSer 139 (Biolegend, 613402, San Diego, CA, USA), p21 (Santa Cruz, sc-397), p27 (Santa Cruz, sc-528), pRb (Cell Signaling, #9309), and pRb-pSer780 (Cell Signaling, #8180). Anti-rabbit and anti-mouse secondary horseradish peroxidase (HRP)-linked antibodies were obtained from GE Healthcare (NA934V, NA931V), and anti-goat antibody was obtained from Sigma-Aldrich (A5420). The immunoreactive bands were visualized using the Western blot Luminol reagent (Santa Cruz Biotechnology, SC-2048).

Paculová H., Kramara J., Šimečková Š., Fedr R., Souček K., Hylse O., Paruch K., Svoboda M., Mistrík M, & Kohoutek J. (2017). BRCA1 or CDK12 loss sensitizes cells to CHK1 inhibitors. Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 39(10).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!