Kimtech polypropylene wipes

Manufactured by Kimberly-Clark

Kimtech polypropylene wipes are a type of lab equipment designed for cleaning and wiping surfaces. They are made from polypropylene material and are intended for use in various laboratory and industrial settings.

Automatically generated - may contain errors

Lab products found in correlation

Nanodrop, by Thermo Fisher Scientific (4 mentions) High resolution microarray scanner, by Agilent Technologies (2 mentions) Cy3 mono reactive dye pack, by GE Healthcare (2 mentions) Nuclease free water, by Thermo Fisher Scientific (2 mentions) Fluoreporter mini biotin xx protein labeling kit, by Thermo Fisher Scientific (1 mentions) Illustra nap 25, by GE Healthcare (1 mentions) Thrombin, by Prolytix (1 mentions)

2 protocols using kimtech polypropylene wipes

Microarray-based IgE Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols

IgE (Fitzgerald), Illustra NAP-25 desalting columns and Cy3 Mono-Reactive Dye Pack (GE Healthcare), NanoDrop (Thermo Scientific), and nuclease free water (Gibco) were used. Microarray equipment is as follows: custom 8×15k and 1×1M DNA microarrays, 8×15k and 1×1M gasket slides, ozone barrier slides, hybridization chambers, scanner cassettes, hybridization oven, and High-resolution Microarray Scanner (all Agilent), Slide rack and wash dishes (Shandon), and Kimtech polypropylene wipes (Kimberly-Clark). FluoReporter Mini-Biotin-XX Protein Labeling Kit (Invitrogen), Streptavidin-Cy3 Conjugate and HABA/Avidin Reagent (Sigma), and dialysis cassettes (3.5k MWCO, Thermo Scientific) were also used.

Martin J.A., Chushak Y., Chávez J.L., Hagen J.A, & Kelley-Loughnane N. (2016). Microarrays as Model Biosensor Platforms to Investigate the Structure and Affinity of Aptamers. Journal of Nucleic Acids, 2016, 9718612.

+ Open protocol

+ Expand

DNA Microarray Protein-Binding Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

The chemicals used were IgE (Fitzgerald), Thrombin (Haematologic Technologies, Inc.), BSA and HSA (Sigma), neuropeptide Y (Pheonix Pharmaceuticals), Illustra NAP-25 desalting columns and Cy3 Mono-Reactive Dye Pack (GE Healthcare), NanoDrop (Thermo Scientific), nuclease free water (Gibco). Microarray equipment consisted of the following: custom 8 × 15 k DNA microarrays, 8 × 15 k gasket slides, ozone barrier slides, hybridization chambers, scanner cassettes, hybridization oven, and High-resolution Microarray Scanner (all Agilent) and slide rack and wash dishes (Shandon) and Kimtech polypropylene wipes (Kimberly-Clark). All DNA was purchased through IDT:

4A018: GGTTGGTTTTTCAATCAGCGATCGCGGAATCCAGGGTTAGGCGGCCAACC (with and without 3′-T₁₀-Biotin moiety).

TFBS: GGTTGGTGTGGTTGG.

Buffers: Binding [PBSMTB]-1x PBS (8.1 mM Na₂HPO₄, 1.1 mM KH₂PO₄, 2.7 mM KCl, 137 mM NaCl, pH 7.4) + 1 mM MgCl₂ + 0.1% Tween-20 and 1% BSA; Washing [PBSM]-1x PBS (8.1 mM Na₂HPO₄, 1.1 mM KH₂PO₄, 2.7 mM KCl, 137 mM NaCl, pH 7.4) + 1 mM MgCl₂; Rinse [R]-1/4 dilution of PBSM and nuclease free water.

Martin J.A., Mirau P.A., Chushak Y., Chávez J.L., Naik R.R., Hagen J.A, & Kelley-Loughnane N. (2015). Single-Round Patterned DNA Library Microarray Aptamer Lead Identification. Journal of Analytical Methods in Chemistry, 2015, 137489.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!