Restriction enzymes were obtained from New England Biolabs, Inc. or In vitrogen. PWO DNA polymerase was from Roche Applied Science (Roche Molecular Biochemicals, Mannheim, Germany). Synthetic DNA for mutagenesis was from Integrated DNA Technologies. A synthetic peptide corresponding to the putative TMIX (sequence Acetyl-KKKEALFVGHFGPIGVCAVYMAFLAKLLLKKK-amide) was purchased from the Alberta Proteomics and Mass Spectrometry Facility and was purified by HPLC and the identity verified by Mass Spectrometry. Deuterium oxide (D2O; 99.9% D); D2O with 1% sodium 2,2-dimethyl-2-silapentane-5-sulphonate (DSS); and, deuterated dithiothreitol (DTT-d6; 98% D) and DPC-d38 (98% D) were purchased from C/D/N Isotopes (Pointe-Claire, Quebec, Canada). CD3COOH (>99% D) was purchased from Sigma Aldrich (Oakville, Ontario, Canada).
Pwo dna polymerase
Manufactured by Roche
Sourced in Germany
Pwo DNA polymerase is a thermostable DNA polymerase enzyme isolated from the hyperthermophilic archaeon Pyrococcus woesei. It is commonly used in high-fidelity PCR applications due to its proofreading capabilities, which help ensure accurate DNA replication.
Automatically generated - may contain errors
Lab products found in correlation
E coli dh5α, by New England Biolabs (3 mentions)
Blastidicin, by InvivoGen (3 mentions)
High pure pcr product purification kit, by Roche (2 mentions)
Taq dna polymerase gotaq, by Promega (2 mentions)
Taq dna polymerase, by Roche (2 mentions)
Dneasy blood tissue kit, by Qiagen (2 mentions)
Human puno card11 plasmid, by InvivoGen (2 mentions)
Rapid dephosphorylation ligation kit, by Roche (2 mentions)
Genelute hp plasmid maxi prep kit, by Merck Group (2 mentions)
Restriction enzyme, by New England Biolabs (1 mentions)
Dpc d38, by CDN Isotopes (1 mentions)
Deuterated dithiothreitol, by CDN Isotopes (1 mentions)
Deuterium oxide, by CDN Isotopes (1 mentions)
Power cho medium, by Lonza (1 mentions)
Qiaquick pcr purification kit, by Qiagen (1 mentions)
Nzy tissue gdna isolation kit, by NZYTech (1 mentions)
Phusion dna polymerase, by Thermo Fisher Scientific (1 mentions)
Dna modifying enzymes, by New England Biolabs (1 mentions)
Isopropyl β d 1 thiogalactopyranoside (iptg), by Avantor (1 mentions)
Sodium dodecyl sulfate (sds), by Serva Electrophoresis (1 mentions)
21 protocols using pwo dna polymerase
1
Optimizing Protein Structure Analysis
2
Constructing the 46F2 small immunoprotein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In order to construct the 46F2 small immunoprotein (46F2SIP) gene, the DNA sequence coding for the scFvOC-46F2 [36 (link)] was amplified by polymerase chain reaction (PCR) using Pwo DNA polymerase (Roche Diagnostics, Milan, Italy), according to the manufacturer’s recommendations, with primers BC-512 (ctcgtgtgcactcggaggtgcagctggtggagtct) and BC-513 (ctctccggagcctaggacggtcagcttggt) containing the ApaLI and BspEI restriction sites, respectively. The amplification product was inserted in ApaLI/BspEI in the pcDNA3.1-epsilonCH4 vector, which provides the scFv gene with a secretion signal required for secretion of proteins in the extracellular medium [44 (link)]. This construct was used to transfect Chinese hamster ovary CHO-K1, as previously described [36 (link)]. The different geneticin-selected clones were screened by FACS on SKMEL28 human melanoma cell line for their ability to secrete 46F2SIP. The amplification products for scFv CGS1-A1 anti-B-FN [56 (link)] and for the genomic sequence of the signal secretion leader peptide [37 (link)] were cloned in pcDNA3.1-Myc-His vector and constructs were used for the stable transfection of CHO cell line, as previously reported [36 (link)]. The 100% positive clones were cultured in serum-free power-CHO medium (Lonza) and expanded for antibodies and purification.
3
Bacterial DNA Manipulation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromosomal DNA isolation was performed according to the procedure of Johansen and Kibenich (1992 (link)) or alternatively, with the NZY Tissue gDNA Isolation kit from NZYTech. Plasmid isolation was carried out using plasmid isolation kits from Roche or Qiagen. Pwo DNA polymerase (Roche), Phusion DNA polymerase (Thermo Scientific), T4 DNA ligase (Biolabs, New England) and restriction enzymes (Biolabs, New England) were used according to the supplier's recommendations. Purification of the PCR products was performed using the High pure PCR product purification kit from Roche or alternatively, the QIAquick PCR purification kit from Qiagen. Purified PCR products or recombinant plasmids were introduced into S. pneumoniae by transformation as described in Kloosterman et al. (2006a (link)). Positive transformants were selected in M17 blood agar or Brain Heart Infusion (BHI) agar containing 0.5% glucose with the appropriate antibiotic and confirmed by PCR and sequencing. L. lactis NZ9000 was transformed with plasmid DNA by electroporation as described before (Carvalho et al., 2011 (link)).
4
Molecular Biology DNA Manipulations
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Standard molecular biology-based methods were used for DNA manipulations. Restriction enzymes and DNA modifying enzymes were obtained from New England Biolabs, Taq DNA polymerase (GoTaq) was obtained from Promega and used for colony PCR, and Pwo DNA Polymerase (Roche) was used for high-fidelity PCR amplifications. Modified DNA sequences were verified using Sanger sequencing (Microsynth, CH).
5
Optimized Chemicals Sourcing for Biochemistry
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
F1,6BP and Antifoam (polypropylene glycol P 2000) were from Sigma-Aldrich Chemie GmbH (Munich, Germany), IPTG was from PEQLAB Biotechnologie GmbH (Erlangen, Germany), Bradford solution was from Biorad and sodium dodecyl sulfate from SERVA Electrophoresis GmbH (Heidelberg, Germany). All other chemical were either from Carl Roth GmbH (Karlsruhe, Germany), Fluka (Taufkirchen, Germany), or Merck KGaA (Darmstadt, Germany) and were of the highest available purity. The crude glycerol was delivered from a biodiesel producer (ADM Hamburg, Germany) and contained 83.20% glycerol, 10.4% water, 6.4% NaCl, with less than 0.01% methanol, and no detectable traces of other organic compounds (according to supplier’s data sheet). All restriction enzymes used were from New England Biolabs (Frankfurt, Germany). The Pwo DNA Polymerase for gene amplification was from Roche Applied Science (Mannheim, Germany), Taq DNA polymerase used for screening-PCR was from Genaxxon Bioscience GmbH (Ulm, Germany).
6
Recombinant Protein Purification Procedure
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ORFs of SdCPR and SdC4H were amplified using Pwo DNA polymerase (Roche). The PCR products were inserted into the expression vector pET28b (Merck Millipore, Burlington, MA, USA) using an In-fusion HD Cloning Kit (Takara Bio Inc.). E. coli BL21 (DE3) cells harboring the expression vector were grown overnight in LB medium with 50 μg mL−1 kanamycin and 1% glucose at 37 °C in a shaking incubator, then diluted 1:25 into fresh LB medium supplemented with 50 μg mL−1 kanamycin. Cells were grown at 37 °C at 200 rpm until absorbance at 600 nm reached 0.4 − 0.6, and then 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) was added. The culture was shaking at 200 rpm at 25 °C overnight for protein expression. The bacterial cells were collected by centrifugation at 3000 rpm for 5 min at 4 °C and washed twice with 4 °C wash buffer (10 mM Tris–HCl [pH 7.5], 150 mM NaCl). Then, the washed cell pellet was suspended in the BugBuster Protein Extraction Reagent (Novagen-Merck Millipore) and His-tag recombinant proteins were purified from the supernatant using MagneHis Ni-Particles (Promega) with elution buffer containing 1 M imidazole.
7
Comparative Evaluation of Taq Polymerase Enzymes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A range of 13 high fidelity, regular, economy and premium Taq polymerase enzymes were selected: Biotaq® (Bioline, London, UK), FastStart® High Fidelity PCR System (Roche, Mannheim, Germany), AmpliTaq Gold® (Applied Biosystems, Warrington, UK), HotStarTaq® DNA Polymerase (Qiagen, Hilden, Gernamy), Phusion® High Fidelity DNA Polymerase (Finnzymes, Espoo, Finland), Taq DNA Polymerase (Roche, Maylan, France), i-MaxTM II DNA Polymerase (iNtRON Biotechnology, Seongnam, Korea), KAPA HiFi™ (Kapa Biosystems, Boston, USA), OneTaq™ DNA Polymerase (New England Biolabs, Hitchin, UK), Vent® DNA Polymerase (New England Biolabs, Hitchin, UK), Deep Vent® DNA Polymerase (New England Biolabs, Hitchin, UK), Pwo® DNA Polymerase (Roche, Maylan, France) and Velocity DNA Polymerase (Bioline, London, UK) (abbreviated names in Table 1 ). The list price of these enzymes for the amount recommended for a single 10 μl reaction (not including tax, handling or shipping) ranged from €0.01 to €0.63 (Spain, June 2013).
8
Overexpression of IRS-4 in RKO and HepG2 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells overexpressing IRS-4 were obtained as previously described [23 (link)] with minor modifications. Briefly, DNA was isolated from RKO cells using DNeasy Blood & Tissue kit (Qiagen). Full-length IRS-4 DNA (3881 bp) was amplified by nested PCR using Pwo DNA polymerase (Roche). The resulting DNA fragments were ligated into the HindIII and EcoR1 sites of pcDNA3.1. The fidelity of the recombinant plasmid was assessed by DNA sequencing. Transfection of RKO and HepG2 cell with pcDNA3.1-IRS-4, herein after pcDNA (IRS-4) was performed using TurboFect (Thermo Scientific) according to the manufacturer's instructions. The empty pcDNA3.1 vector was used as a negative control. Stable transfectants were obtained after selection with G418 for different periods of time.
9
Telomere Length Analysis by STELA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
STELA were performed according to standard protocols5 (link). Briefly, genomic DNA was extracted using phenol/chloroform and diluted to 10 ng/μl in 10 mM Tris-HCl (pH 7.5). One microliter of this DNA solution were further diluted to 250 pg/μl in 1 mM Tris-HCl (pH 7.5) containing 1 μM Telorette2 linker. One microliter of this DNA/Telorette 2 solution were used in PCR reactions containing 0.5 μM 21q family primers 10q21T and M449 (Supplementary Table 1 ), 0.5 μM Teltail primer and 0.5 U of a 10:1 mixture of DreamTaq DNA polymerase (Thermo Fisher Scientific) and Pwo DNA polymerase (Roche). Following 0.5% TAE agarose gel electrophoresis and southern blotting, individual telomere bands were detected by a p32-labeled telomeric TTAGGG probe.
10
Construction and Verification of Recombinant pGKL Elements
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All of the strains used in this study are listed in Table 2 . Escherichia coli cells were grown at 37°C in 2xTY medium which was supplemented with kanamycin (50 μg/ml) or ampicilin (100 μg/ml) for selection of transformants. Transformations of E. coli cells were performed by electroporation using Gene Pulser Xcell (Bio-Rad). K. lactis cells were grown at 28°C in YPD medium which was supplemented with G418 (250 μg/ml) and/or hygromycin B (200 μg/ml) for selection of transformants. Transformations of K. lactis cells were performed using the one-step LiCl method [75 (link)] and followed by five-hour incubation in non-selective conditions immediately after transformation. For detailed descriptions of plasmids and elements used in this study see S1 Table . Constructed pGKL elements were verified by PCR and subsequent sequencing of amplified products.
The nucleotide sequences of the primers used for construction, verification and sequencing of recombinant pGKL elements, and RACE-PCR amplification are listed inS2 Table . All polymerase chain reactions (PCRs) were performed using Taq DNA polymerase (Roche). PCRs for construction of recombinant pGKL elements were performed using mixture of Taq DNA polymerase (Roche) and Pwo DNA polymerase (Roche) in a 99:1 volume ratio, respectively.
The nucleotide sequences of the primers used for construction, verification and sequencing of recombinant pGKL elements, and RACE-PCR amplification are listed in
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!