Urinary nucleic acids were extracted using the QIAquickR gel extraction kit (Qiagen GmbH, Hilden, Germany). Each frozen urine sample (1 mL) was melted down at room temperature and treated with 500 µL of QG buffer (contained in QIAquickR gel extraction kit). After incubation for 10 min at 50℃, 500 µL of isopropanol was added and the sample was mixed. The sample was transferred onto a QIAquick column, which binds nucleic acids, and the column was placed into a 2 mL collection tube and centrifuged for 1 min at 13,000 rpm. The aqueous flow-through was discarded and the QIAquick column was placed into the same collection tube. After addition of 500 µL of QG buffer, the column was centrifuged for 1 min at 13,000 rpm, and bound nucleic acids were washed with 750 µL of PE buffer (contained in QIAquickR gel extraction kit) and centrifugation for 1 min. The aqueous flow-through was discarded and the QIAquick column was centrifuged for an additional 1 min at 13,000 rpm and placed into a clean 1.5 mL microcentrifuge tube, and nucleic acids were eluted by addition of 50 µL of EB buffer (contained in QIAquickR gel extraction kit) to the center of the QIAquick membrane and centrifugation for 1 min at 13,000 rpm. The nucleic acids dissolved in EB buffer were stored at -20℃ until use.
Qiaquickr gel extraction kit
Manufactured by Qiagen
Sourced in Germany
The QIAquick Gel Extraction Kit is a laboratory tool designed for the purification of DNA fragments from agarose or polyacrylamide gels. It allows the extraction and recovery of DNA from gel slices, enabling further downstream applications such as sequencing, cloning, or enzymatic reactions.
Automatically generated - may contain errors
Lab products found in correlation
Veriti thermal cycler, by Thermo Fisher Scientific (3 mentions)
48 capillary array 3730 dna analyzer, by Thermo Fisher Scientific (2 mentions)
Platinum taq dna polymerase high fidelity, by Thermo Fisher Scientific (1 mentions)
Bigdye xterminator purification kit, by Thermo Fisher Scientific (1 mentions)
Taq polymerase, by Takara Bio (1 mentions)
Directprep 96 miniprep kit, by Qiagen (1 mentions)
Phusion hot start 2 high fidelity dna polymerase, by Thermo Fisher Scientific (1 mentions)
Pgem t vector, by Promega (1 mentions)
Bigdye xterminator kit, by Thermo Fisher Scientific (1 mentions)
Bigdye terminator ver 3.1 cycle sequencing kit, by Thermo Fisher Scientific (1 mentions)
Abi 3730 genetic analyzer, by Thermo Fisher Scientific (1 mentions)
6 protocols using qiaquickr gel extraction kit
1
Urinary Nucleic Acid Extraction using QIAquick Kit
2
Mitochondrial COI Gene Amplification and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total genomic DNA was extracted followed by QIAamp DNA Mini Kit standard protocol. The published primer pair, FishF1-5′TCAACCAACCACAAAGACATTGGCAC3′ and FishR1-5′TAGACTTCTGGGTGGCCAAAGAATCA3′ (Ward et al. 2005 (link)) was used for amplification of partial mitochondrial cytochrome c oxidase subunit I (mtCOI) (∼650 bp) gene segment in a Veriti® Thermal Cycler (Applied Bio systems, Foster City, CA). The 25 µl PCR mixture contains 10 pmol of each primer, 100 ng of DNA template, 1 × PCR buffer, 1.0–1.5 mM of MgCl2, 0.25 mM of each dNTPs, and 0.25 U of Platinum Taq DNA Polymerase High fidelity (Invitrogen, Life Science Technologies). PCR conditions were: initial denaturation at 94 °C (2 min) followed by 30 cycles at 94 °C (45 s), 50 °C (45 s), and 72 °C (1 min), and a final elongation at 72 °C (8 min). The PCR amplified products were checked in 1% agarose gel containing ethidium bromide (10 mg/ml). Further, the PCR products were purified using QIAquickR Gel extraction kit (QIAGEN Inc., Germantown, MD), and cycle sequencing products were cleaned by using standard BigDye X Terminator Purification Kit (Applied Biosystems, Foster City, CA). Sequencing was done bi-directionally in 48 capillary array 3730 DNA Analyzer (Applied Biosystems, Foster City, CA) following Sanger sequencing methods.
3
Viral DNA Sequencing and Phylogenetic Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Positive samples were purified from the gel or from the PCR product, according to the manufacturer's instructions using a purification kit (QIAquick(r) Gel Extraction Kit or QIAquick(r) PCR Purification Kit, QIAGEN Inc., Hilden, Germany). Purified DNA was sequenced using the Big Dye Kit (v. 3.1) (Applied Biosystems, Foster City, CA, USA) on an ABI Prism sequencer 3130XL DNA Sequencer (Applied Biosystems, Foster City, USA). The oligonucleotides used in the sequencing reaction were the same previously described in the amplification protocols.
The sequences obtained by both polymerase and capsid region, were edited using the BioEdit Sequence Alignment Editor program (v.7.1.3.0) available from:www.mbio.ncsu.edu/bioedit/bioedit.html and compared with prototype sequences from GenBank database (National Center for Biotechnology Information, U.S. available from: www. ncbi.nlm.nih.gov). The phylogenetic analysis was performed on the MEGA 5.2 program25 (www.megasoftware.net) using the Kimura 2-parameter method with 2,000 bootstrap replicates. The sequences of this work were also deposited in the same database with the accession numbers: KF924388-KF924393. None of the samples were identified as NoVs by genomic DNA sequencing.
The sequences obtained by both polymerase and capsid region, were edited using the BioEdit Sequence Alignment Editor program (v.7.1.3.0) available from:
4
mtCytb Gene Amplification and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total genomic DNA was extracted by standard phenol-chloroform-isoamyl alcohol (PCI) protocol (Sambrook and Russell 2001 ), checked in 1% agarose gel electrophoresis, and stored –30 °C at Centre for DNA Taxonomy laboratory, Zoological Survey of India, Kolkata. The published primer pair (mcb 398: 5′TACCATGAGGACAAATATCATTCTG3′ and mcb 869: 5′CCTCCTAGTTTGTTAGGGATTGATCG3′) (Verma and Singh 2002 ) was used to amplify the partial fragment of mtCytbgene in a Veriti® Thermal Cycler (Applied Bio systems, Foster City, CA, USA) with the standard thermal profile. The 25 µl PCR mixture contains 10 pmol of each primer, 20 ng of DNA template, 1X PCR buffer, 1.0–1.5 mM of MgCl2, 0.25 mM of each dNTPs, and 1U of Taq polymerase (Takara BIO Inc., Shiga, Japan). The PCR products were checked in 1% agarose gel and purified using a QIAquickR Gel extraction kit (QIAGEN Inc., Germantown, MD, USA). The bidirectional sequencing of each sample was carried out by 48 capillary array 3730 DNA Analyzer (Applied Biosystems, Foster City, CA, USA) following Sanger sequencing methods available at ZSI, Kolkata.
5
HBV Genome Sequencing from cccDNA and rcDNA
6
Mitochondrial Cytochrome b Sequencing for Shrew Identification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The genomic DNA was extracted from both holotype and paratype specimens by standard phenolchloroform isoamyl alcohol method 54 . The extracted DNA was visualized through 1% agarose gel electrophoresis. The published primer pair (mcb 398: 5′-TACCATGAGGACAAATATCATTCTG-3′ and mcb 869: 5′-CCTCCTAGTTTGTTAGGGATTGATCG-3′) 55 was used to amplify the widely applied mitochondrial Cytochrome b (mtCytb) gene segment for the identi cation of shrew species 56, 57 . The 25 ml PCR mixture comprises 10 pmol of each primer, 20 ng of DNA template, 1X PCR buffer, 1.0-1.5mM of MgCl2, 0.25mM of each dNTPs, and 1 U of Platinum Taq DNA Polymerase High delity (Invitrogen, Life Science Technologies). The PCR reaction was performed in Veriti®Thermal Cycler (Applied Biosystems, Foster City, CA) with the published thermal pro le. The PCR products were purified using a QIAquickR Gel extraction kit (Qiagen Inc., Germantown, MD) with standard protocol. The cycle sequencing was executed by using BigDye®Terminator ver. 3.1 Cycle Sequencing Kit (Applied Biosystems, Inc.) and 3.2 picomoles of each primer on Veriti®Thermal Cycler. The products were cleaned by BigDye X-terminator kit (Applied BiosystemsInc.) with standard protocol and subsequently bidirectional sequenced by the 48 capillary ABI 3730 Genetic Analyzer.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!