The largest database of trusted experimental protocols

9 protocols using pultra hot

1

Lentiviral Plasmid Encoding Ca2+ and Caspase-3 Indicators

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lentiviral plasmid encoding GCaMP6s and mCherry were purchased from Addgene (Watertown, MA, USA; #80146, a gift from Dr. Darrell Kotton and pUltra-hot, and #24130, a gift from Dr. Malcolm Moore, respectively). Lentiviral plasmid encoding caspase-3 (Cas-3) indicator was engineered in the lab using the pUltra-hot lentiviral vector for bi-cistronic expression of mCherry and Cas-3 indicator (GANLS-DEVD-BNES, #50835, Addgene, a gift from Dr. Robert Campbell). Lentiviral plasmids encoding organelle-targeted Ca2+ indicators (R-CEPIA1er, G-CEPIA1er and CEPIA2mt) were a gift from Dr. Masamitsu Iino lab. Lentiviruses (LVs) were produced by transfection of HEK-293T cells (Cat. No. CRL-3216, American Type Culture Collection, ATCC, Manassas, VA, USA) using Lipofectamine 2000 (Cat. No. 11668-027, Thermo Fisher Scientific, Waltham, MA, USA). Supernatant containing viral particles was collected, cleared by centrifugation, and frozen at −80 °C for later usage.
+ Open protocol
+ Expand
2

Stable Overexpression of Murine Ezh2 in Pre-Osteoblasts

Check if the same lab product or an alternative is used in the 5 most similar protocols
To stably overexpress murine Ezh2 in mouse pre-osteoblasts, the Ezh2 transcript was amplified from mouse cDNA with the primers GCTGCAGGTCCGATCCACCGGTGACGAAGAATAATCATG (forward) and GACTCCGGAACGAATTCTGATCACTAAGGCAGCTGTTTCAG (reverse) and cloned into the lentiviral expression vector pUltra-hot (Addgene; Watertown, MA; Cat. #24130). Thereafter, viral particles were generated following standard procedures and MC3T3-E1 cells were infected over three cycles of infection. Successful Ezh2 overexpression was tested by RT-qPCR and western blotting. As a control, an empty pUltra-hot vector was used.
+ Open protocol
+ Expand
3

Mitochondrial Matrix pH Measurement

Check if the same lab product or an alternative is used in the 5 most similar protocols
In order to measure mitochondrial matrix pH, we used another ratiometric dye namely mito-SypHer, which was a gift from Nicolas Demaurex (Addgene plasmid # 48251). Mito-SypHer was cloned into the lentiviral expression vector pUltra-hot, which was a gift from Malcolm Moore (Addgene plasmid # 24130) (for details see Sec. 2.3). The respective virus was added to the cells resulting in an overexpression of SypHer located in the mitochondria, which was checked microscopically. Transduced cells were seeded and cultivated according to the FLIM protocol. Per experiment and per treatment, 100 cells were recorded, each being imaged with two different excitation wavelengths (405 and 488 nm). Emission was recorded at 525 nm. For calculation of the pH value corresponding to the emission ratio (405/488), nigericin-high potassium method was performed according to the BCECF calibration described above. For assessment of mitochondrial matrix pH in the amyloid precursor protein (APP)-overexpressing model and respective control cells, cells were cotransduced for MitoSypHer and APP/control vector. Subsequently, 20,000 cells were analyzed for MitoSypHer fluorescence intensity using FACS analysis (FACS Calibur). Calibration was performed using the nigericin-high potassium method mentioned above.
+ Open protocol
+ Expand
4

SARS-CoV-2 Spike Pseudovirus Production

Check if the same lab product or an alternative is used in the 5 most similar protocols
Spike-containing SARS-CoV-2 pseudovirus was generated as previously described [11 (link)]. Briefly, 293T cells grown to 70% confluency were transfected with pcDNA3.1-SARS2-Spike (Addgene, 145032, Watertown, MA, USA), psPAX2 (Addgene, 12260), and pUltra-hot (Addgene, 24130) plasmids using Lipofectamine 3000 reagent (Thermo Fisher Scientific). After 6 h, the medium was replaced with fresh medium. After 48 h, the medium was collected and concentrated with PEG-itTM virus precipitation solution (System Biosciences, Palo Alto, CA, USA). The MOI was calculated using the Lenti-XTM qRT-PCR Titration Kit (Takara Bio, Kusatsu, Japan) according to the manufacturer’s manual.
+ Open protocol
+ Expand
5

Ratiometric pH Sensors Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
SypHer mt (Addgene #48251), GW1-Mito-pHRed (Addgene #31474), and pUltra-hot (Addgene #24130) were gifts from Nicolas Demaurex, Gerry Yellen, and Malcolm Moore, respectively. SypHer mt allows the expression of a pH-sensitive ratiometric cpYFP derivative that contains two mitochondrial matrix localization sequences at its N-terminus.28 (link),29 (link) GW1-Mito-pHRed encodes for a pH-sensitive ratiometric m-Keima derivative that contains four cytochrome C oxidase subunit VIII (Cox 8) tags to target it to the mitochondria.30 (link) We cloned the pH-sensors into the lentiviral expression vector pUltra-hot to produce viruses for an efficient, moderate, and stable expression of the pH indicators in our target cells. For cloning procedure, please see SI.
+ Open protocol
+ Expand
6

Generating Lentiviral Constructs for p190A Overexpression and Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols
All p190A expression constructs were synthesized with an N-terminal Myc-tag by Gene Oracle, Inc. and cloned into the lentiviral vector pUltra-hot from Addgene, plasmid #24130. The entire cDNAs for wild-type or mutant p190A forms were verified by Sanger sequencing. Validated pLKO.1 puro shRNA E-cadherin lentiviral plasmid was purchased from Addgene, plasmid #18801. Validated pLenti-EmGFP-LATS2/1-kd plasmid to deplete LATS1 and LATS2 together was likewise obtained from Addgene, plasmid #52085. Lentiviral expression construct encoding mouse E-cadherin was similarly purchased from Addgene, plasmid #18804. Lentiviral pZIP vectors encoding shRNAs targeting human p190A were purchased from transOMIC technologies Inc; cat. no. TRHS1000–35 (ARHGAP35/p190A) and validated previously39 (link).
+ Open protocol
+ Expand
7

Constructing Mbd3 Expression Vectors

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mbd3 expression vectors were constructed by subcloning full-length mouse Mbd3 from a lentiviral FUIGW-Mbd3-Flag vector we previously created into XbaI/EcoRI sites of pUltra-hot (Addgene plasmid # 24130). For Mbd3-myc, the reverse primer included the full Myc sequence. PCR was carried out using the KOD Hot Start Polymerase Kit (EMD Millipore) with corresponding primer pairs. PCR products were ligated into double-digested pUltra-hot vector and inserted ligations were confirmed by PCR and DNA sequencing (Genewiz, Inc). For the shRNA vector, the Mbd3 target sequence was designed based on the RNAi Consortium library top hits for mouse Mbd3. Details for pLKO3G shMbd3 and shcontrol construction are listed in S4 Table.
+ Open protocol
+ Expand
8

Engineered Plasmids and Lentivirus

Check if the same lab product or an alternative is used in the 5 most similar protocols
Plasmids pUltra (#24129) and pUltra-hot (#24130) were purchased from Addgene. The eGFP and mCherry alleles were replaced with H2B-eGFP and H2B-mCherry from Addgene plasmids #11680 and #20972, respectively. Human and mouse PAQR8 cDNA sequences were synthesized by Integrated DNA Technologies, sequence-verified, and cloned into the above-modified pUltra plasmid. Sense and anti-sense oligos for each sgRNA were ligated into BsmB1-digested LRG2.1 vector (Addgene #108098) or LRmCherry2.1 vector (Addgene #108099). Lentivirus was produced by transfecting HEK293T cells with polyethylenimine (Polysciences #23966), pMD2.G (Addgene #12259), psPAX2 (Addgene #12260), and the plasmid of interest.
+ Open protocol
+ Expand
9

Lentiviral Constructs for p190A and E-cadherin

Check if the same lab product or an alternative is used in the 5 most similar protocols
All p190A expression constructs were synthesized with an N-terminal Myc-tag by Gene Oracle, Inc. and cloned into the lentiviral vector pUltra-hot from Addgene, plasmid #24130. The entire cDNAs for wild-type or mutant p190A forms were verified by Sanger sequencing. Validated pLKO.1 puro shRNA E-cadherin lentiviral plasmid was purchased from Addgene, plasmid #18801. Validated pLenti-EmGFP-LATS2/1-kd plasmid to deplete LATS1 and LATS2 together was likewise obtained from Addgene, plasmid #52085. Lentiviral expression construct encoding mouse E-cadherin was similarly purchased from Addgene, plasmid #18804. Lentiviral pZIP vectors encoding shRNAs targeting human p190A were purchased from transOMIC technologies Inc; cat. no. TRHS1000-35 (ARHGAP35/p190A) and validated previously [39 (link)].
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!