4d x unit

PX459 V2.0 plasmid was obtained from Addgene (62988). The following gRNA primer 5′ – CACCGAGAAGTGATCATGGAGACCA-3′ was cloned into PX459 using BbsI overhangs. HeLa cells were transfected with the plasmid followed by puromycin selection (1.5 μg/ml) 48 h post transfection. Cells were then seeded into 96-well plates to ideally obtain one cell per well, which were then subsequently expanded and screened for KO clones. For generation of JIP3 KO line, three synthetic gRNAs (Synthego) were used: GACTTGGTGCCTGTGGTGCT, GGCTGCAGGCTCTCGTTGAG, and TGACCTGTACTTCCATGTTG. To prepare the RNP complexes, Cas9 2NLS nuclease (Streptococcus pyogenes) (Synthego) and the reconstituted sgRNA were added to the Nucleofector solution (Lonza). Mixture was incubated at RT for 15 min and added to freshly harvested HeLa cells and electroporated using 4D X Unit (Lonza). Positive KO clones were screened by PCR using primer flanking the cut sites.

Cas9 ribonucleoprotein complexes were complexed in vitro as previously described^{48 (link)}. Briefly, lyophilized tracrRNA & crRNA (Dharmacon) were resuspended to 160 uM, combined, and incubated at 37°C for 30 minutes to form an RNA duplex at 80 uM. An equal volume of 40 uM Cas9 protein solution (UCB Macrolab) was added and incubated at 37°C for 15 minutes to produce crRNPs at 20 uM concentration. Target sequences: DNAH5, AGACCCGAGAAAGATCTCGT; DNAI1, GATGAATACCGGGACCAGGT; CYPA, AGGTCCCAAAGACAGCAGGT. Early passage HBEs were then trypsinized at 50–75% confluency, counted, separated into aliquots of 100,000 cells per reaction, and spun down at 200 x g x 5 minutes. Single reaction aliquots were then resuspended in 20 µL Lonza nucleofection buffer P3, mixed with 3.5 µL crRNP solution, placed in wells of a 16-well cuvette, and electroporated using program EH100 on a Lonza 4D X unit. Immediately after nucleofection, cells were mixed with 80 µL prewarmed Pneumacult Ex Plus medium and returned to the incubator for 30 minutes. Cells were then moved to collagen coated 12 well plates with prewarmed Pneumacult Ex Plus medium and allowed to recover for approximately two days, when the 12 well plates approached 70% confluency. At this point cells were seeded on the underside of transwell membranes as described above.

sgRNAs targeting human TRAC, B2M, CIITA, TRBV12-3 and Fut8 were purchased from IDT. Culture medium was pre-warmed in a 37 °C incubator. Ribonucleoprotein (RNP) complex composed of Cas9 protein and sgRNA was formed at RT for 20 min. The supernatant was aspirated completely from the cell pellet which was then re-suspended in 20 μl P3 buffer for primary T cells, SE buffer for Jurkat cell line or SF buffer for ExpiCHO cell line (Lonza). Cell suspension, RNP complex and enhancer (IDT) were mixed well and transferred into 16-well strip tubes (Lonza). Electroporation was performed in Lonza 4D-x unit with program EO-115 for primary T cells, CL120 for Jurkat cell line or DU158 for ExpiCHO cell line. 100ul pre-warmed culture medium was immediately added to the cells after electroporation, and then transferred completely into pre-warmed medium for culture. sgRNAs are listed in Supplementary Table 2.