Crispr rna crrna

The procedure used is similar to that described by Keatinge and colleagues⁵³ (link) but with small variations. One-cell stage zebrafish embryos were injected into the yolk with 1 nL injection solution containing 62.5 ng/μL crispr RNA (crRNA, Sigma), 62.5 ng/μL tracrRNA (Sigma, cat.tracrRNA05N), 1:8 dilution Cas9 protein (New England Biolabs, cat. M0386M; diluted in buffer B, New England Biolabs, cat. B802S) and 1:40 dilution of phenol red (Sigma Aldrich). The crRNA (5′CUCAUCCUCCACCACCCAGG) was designated to target a section of exon 5 of the zebrafish gene baz1b (ensembl gene ID: ENSDART00000158503.2) overlapping a restriction site for the Bsl1 enzyme (New England Bioscience) which includes a PAM site. Once a pair of founders was identified (outcrossing them to WT and genotyping the offspring by PCR) they were in-crossed and resulting F1 genotyped. All identified homozygous individuals (baz1b^−/−) from the F1 were individually outcrossed with different non-related WT fish, eggs collected and combined to randomly select a population of heterozygous (baz1b^+/−) zebrafish to constitute the F2 (minimum of two tanks of 50 individuals each). Finally, F2s were in-crossed and F3 genotyped to establish a breeding stock of fish from each genotype. Primers used for genotyping: forward 5′ AGAAGAAGAAATGGGTCATGCC and reverse 5′ CCTCTTAAACCATCTCACCTTGT.

The Catsperq^−/− mice were generated using CRISPR/Cas9-based gene targeting. Two guide RNAs gRNA1 (5′-accctggaattgtctcgggt-3′) and gRNA2 (5′-taagtcaagtgtcaacgacc-3′) targeting the coding region of Catsperq were designed using CRISPR direct software (http://crispr.dbcls.jp/) (45 (link)). Zygotes were isolated on the day of the coagulation plug (=E0.5) from superovulated female mice (B6D2F1) mated with B6D2F1 males. To remove cumulus cells, zygotes were incubated in hyaluronidase solution (0.33 mg/mL) (Sigma-Aldrich). Ribonucleoprotein complexes containing synthesized CRISPR RNA (crRNA) (Sigma-Aldrich), transactivating crispr RNA (tracrRNA) (TRACRRNA05N-5NMOL, Sigma-Aldrich), and CAS9 protein (A36497, Thermo Fisher Scientific) were electroporated into fertilized eggs using a NEPA21 superelectroporator (NEPA GENE) (46 (link)). Electroporated zygotes were incubated in potassium simplex optimization medium (47 (link)) at 37 °C and 5% CO₂ until the next day. Two-cell embryos were transferred into the oviducts of pseudopregnant recipient females. The resulting pups were genotyped using primers TMEM249_F (5′-tgtggtcaatagaaaagcccct-3′), TMEM249_R (5′-cgcgtctcctcccacaagtac-3′) and TMEM249_R′ (5′-aaaggaggccagggctcaggcccca-3′).