Cells were plated in a Nunc Lab-Tek II chamber slide (Thermo) at 5 × 103 cells per well. The next day, cells were transduced with a construct expressing 2×FYVE-mSCAR to label endosomes. Forty-eight hours postransduction, cells were infected with IAV at an MOI of ∼10. Sixty minutes postinfection, cells were washed with PBS, fixed in 4% PFA, permeabilized with 0.1% Triton X-100, blocked with fetal bovine serum (FBS), and stained for influenza virus nucleoprotein (1:200; Abcam; catalog no. ab128193) and antibody conjugate AF-488 goat anti-mouse IgG (H+L) (Thermo; 1:1,000). Images were acquired on a DeltaVision OMX SR imaging system using a ×60 widefield oil immersion objective (Olympus) with an exposure time of 50 ms, 5.0% transmission for the AF-488 channel, an exposure time of 100 ms, 10% transmission for the A568 channel, and an exposure time of 100 ms, 10% transmission for the DAPI channel.
Af 488 goat anti mouse igg h l
Manufactured by Thermo Fisher Scientific
The AF-488 goat anti-mouse IgG (H+L) is a secondary antibody conjugated with Alexa Fluor 488 dye. It is designed to detect and visualize mouse immunoglobulin G (IgG) molecules in various immunoassay applications.
Automatically generated - may contain errors
Lab products found in correlation
Nunc lab tek 2 chamber slide, by Thermo Fisher Scientific (2 mentions)
Deltavision omx sr imaging system, by Olympus (2 mentions)
Vectashield dapi mounting medium, by Vector Laboratories (2 mentions)
Hep 2 ana kit, by Inova Diagnostics (2 mentions)
Nebuilder hifi dna assembly, by New England Biolabs (1 mentions)
60 widefield oil immersion objective, by Olympus (1 mentions)
4 protocols using af 488 goat anti mouse igg h l
1
Fluorescent Labeling of Influenza Virus
2
V5-tagged CTSL Localization in Endosomes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The coding sequence of CTSL was tagged with a 3′V5 and cloned into CSIN using NEBuilder HiFi DNA Assembly (NEB) with primers CTSL_3′_V5_F, ACAGACTGAGTCGCCCGGGGGGGATCCGGCCGAGAGGGCCGCCACCATGAATCCTACACTCATCCTTGC , and CTSL_3′_V5_R, GGGGGAGGGAGAGGGGCGGATCAGGCCAGAGAGGCCTCACGTAGAATCGAGACCGAGGAGAGGGTTAGGGATAGGCTTACCCACAGTGGGGTAGCTGGCT . Cells stably expressing this 3′V5-tagged CTSL were plated in a Nunc Lab-Tek II chamber slide (Thermo) at 5 × 103 cells per well. The next day, cells were transduced with a construct expressing 2×FYVE-mSCAR to label endosomes. Forty-eight hours postransduction, cells were fixed in 4% PFA, permeabilized with 0.1% Triton X-100, blocked with FBS, and stained for V5 (Invitrogen; catalog no. 46-0705; 1:1,000) and antibody conjugate AF-488 goat anti-mouse IgG (H+L) (Thermo; catalog no. 1:1,000). Images were acquired on a DeltaVision OMX SR imaging system using a ×60 widefield oil immersion objective (Olympus) with an exposure time of 50 ms, 5.0% transmission for the AF-488 channel, an exposure time of 100 ms, 10% transmission for the A568 channel, and an exposure time of 100 ms, 10% transmission for the DAPI channel.
3
Detection of Anti-nuclear Antibodies in Mice
4
Detection of Anti-nuclear Antibodies in Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Anti-nuclear antibodies were detected in the sera of mice by using HEp-2 ANA kit (Inova Diagnostics, Inc., San Diego, CA, USA). All procedures were performed according to the manufacturer's instructions. Mouse sera were diluted 1:80 and incubated on HEp-2-fixed substrate slides for one hour at room temperature in a humidified chamber. After three 5-min washes with PBS, the substrate slides were treated with a 1:100 dilution of AF 488 goat anti-mouse IgG (H+L) (Life Technologies) for 45 min at room temperature. After three washes, slides were treated with Vectashield DAPI-mounting medium (Vector Laboratories) and overlaid with glass coverslips. Fluorescence was detected by fluorescence microscopy at 400× magnification by using a Nikon microscope, and all images were obtained with exposure of 200 ms.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!