Rt reagent kit

Manufactured by Thermo Fisher Scientific

Sourced in United States

The RT Reagent Kit is a set of reagents designed for reverse transcription (RT) reactions. It includes the necessary components to convert RNA into complementary DNA (cDNA) which can then be used for further downstream applications such as gene expression analysis or next-generation sequencing.

Automatically generated - may contain errors

Lab products found in correlation

43 protocols using rt reagent kit

HA-Piwil4 Immunoprecipitation and RNA Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

HEK293T cells were transfected with constructs HA-Piwil4 and pIL4 or pIL4m, respectively. Two days later, the 293T cells were collected and lysed in RIP buffer, following the manufacturer's protocol (Magna RIP kit, Millipore). The cell lysates were then separated by centrifugation at 14 000 rpm for 15 min at 4°C. The anti-HA antibody (M180-3, MBL) was mixed with the magnetic beads protein A/G and incubated with constant rotation for 30 min at room temperature. Subsequently, the anti-HA antibody and protein A/G-coated magnetic beads were then mixed with the lysates and incubated at 4°C for 4 h. The beads were then precipitated using a magnetic separator, followed by six washes of cool RIP buffer. The immunoprecipitated RNA samples were then extracted and reversely transcribed using an RT reagent kit (Invitrogen) with specific primers, followed by qPCR. A CFX 96 Real-Time System (Bio-Rad) was used for quantitative real-time PCR (qRT-PCR) amplification. Results were normalized to input RNA levels and plotted as fold enrichment relative to that of the IgG control.

Zhong F., Zhou N., Wu K., Guo Y., Tan W., Zhang H., Zhang X., Geng G., Pan T., Luo H., Zhang Y., Xu Z., Liu J., Liu B., Gao W., Liu C., Ren L., Li J., Zhou J, & Zhang H. (2015). A SnoRNA-derived piRNA interacts with human interleukin-4 pre-mRNA and induces its decay in nuclear exosomes. Nucleic Acids Research, 43(21), 10474-10491.

+ Open protocol

+ Expand

Quantifying PD-L1 and α1-nAchR mRNA Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols

To quantify PD-L1 and α1-nAchR mRNA expression levels, total RNAs were extracted from cells using TRIzol reagent™ (Invitrogen, Carlsbad, CA, USA) and cDNA was synthesized using commercially available RT reagent kit (Invitrogen) according to the manufacturer’s instructions. PCR was carried out in reaction mixture containing Taq DNA polymerase, primers, and cDNA. Equal volumes of PCR products were separated by electrophoresis on 2% agarose gels. β-actin was used as an internal control. Quantitative real time PCR (qRT-PCR) was performed using a Rotor-Gene SYBR^® Green qPCR Kit Master Mix (Qiagen, Valencia, CA, USA) and carried out in a Real Time PCR Rotor-Gene Q Machine (Qiagen). All experiments were performed in triplicates. The relative expression of PD-L1 was normalized to β-actin expression. Fold change of test gene mRNA expression was determined using the 2^-∆∆Ct method (∆Ct = difference in threshold cycles for the test gene, ∆∆Ct = difference in ∆Ct between the control and treatment group with nicotine or gefitinib).

Yeo C.D., Kim I.K., Ban W.H., Kang H.S., Kim J.W., Kim S.J., Park J.Y, & Lee S.H. (2019). Chronic nicotine exposure affects programmed death-ligand 1 expression and sensitivity to epidermal growth factor receptor-tyrosine kinase inhibitor in lung cancer. Translational Cancer Research, 8(Suppl 4), S378-S388.

+ Open protocol

+ Expand

Quantifying Inflammatory Markers in Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from the tissues was isolated using a Pure Link RNA mini kit (Invitrogen, USA) and reverse-transcribed to cDNA using the PrimeScript RT reagent Kit with gDNA Eraser. Primers for quantitative qPCR were as follows: tumor necrosis factor (Tnf)-α, forward (CCTGTAGCCCACGTCGTAG) and reverse (GGGAGTAGACAAGGTACAACCC); monocyte chemoattractant protein-1 (Mcp-1), forward (TAAAAACCTGGATCGGAACCAAA) and reverse (GCATTAGCTTCAGATTTACGGGT).

Han F., Kan C., Wu D., Kuang Z., Song H., Luo Y., Zhang L., Hou N, & Sun X. (2022). Irisin protects against obesity-related chronic kidney disease by regulating perirenal adipose tissue function in obese mice. Lipids in Health and Disease, 21, 115.

+ Open protocol

+ Expand

RT-qPCR Analysis of EMT Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

The total RNA was isolated from cultured cells using a Trizol reagent (Invitrogen) and reverse transcribed into cDNA using the PrimeScript RT reagent kit according to the manufacturer’s instructions. mRNA levels of target genes were quantified and normalized to GAPDH using SYBR Green Master Mix with ABI PRISM 7900 system (Applied Biosystems, Foster City, CA, USA).
The primer sequences used for the qRT-PCR were as follows:
GAPDH, Forward: 5’-ACGGGAAGCTCACTGGCATGG-3’; Reverse: 5’-GGTCCACCACCCTGTTGCTGTA-3’; E-Cadherin, Forward: 5’-TGCCCAGAAAATGAAAAAGG-3’; Reverse: 5′-GTGTATGTGGCAATGCGTTC-3′; Vimentin, Forward: 5’-GAGAACTTTGCCGTTGAAGC-3’; Reverse: 5’-GCTTCCTGTAGGTGGCAATC-3’; α-SMA, Forward: 5’-CTATGCCTCTGGACGCACAACT-3’; Rverse: 5’-CAGATCCAGACGCATGATGGCA-3’.

Lin C.H., Wan C., Liu W.S, & Wang H.H. (2021). PM2.5 Induces Early Epithelial Mesenchymal Transition in Human Proximal Tubular Epithelial Cells through Activation of IL-6/STAT3 Pathway. International Journal of Molecular Sciences, 22(23), 12734.

+ Open protocol

+ Expand

Quantitative Analysis of Wnt Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total cellular RNAs were isolated using peqGold TriFast reagent (Peqlab) according to the manufacturer’s instructions. The concentrations of RNA were determined using a NanoDrop ND-2000 (NanoDrop). The first‐strand cDNA synthesis using total cellular RNAs as the template was performed with Invitrogen RT Reagent Kit. qRT-PCR was performed with iTaq Universal SYBR Green Supermix (Bio-Rad Laboratories GmbH) as the dsDNA fluorescence dye using CFX96 Real-Time PCR Detection Systems (Bio-Rad Laboratories, Inc.). The reactions were performed under the following conditions: 95°C for 3 min; 40 cycles of 95°C for 10 s, 60°C for 30 s, and 72°C for 30 s; and a melting curve from 65°C to 95°C. The results of qRT-PCR were defined from the threshold cycle (Ct), and relative mRNA levels were determined using the 2^−△△Ct method with beta-actin (β-actin) as an internal control. The following primer pairs used for qRT-PCR:

wnt3a: 5′-CCTGCACTCCATCCAGCTACA-3′ and

5′-GACCTCTCTTCCTACCTTTCCCTTA-3′;

wnt7b: 5′-CCCGGCAAGTTCTCTTTCTTC-3′ and

5′-GGCGTAGCTTTTCTGTGTCCAT-3′;

Wnt9a: 5′-TGCCTTCCTCTATGCCATCTCC-3′and

5′-TCCTTGACGAACTTGCTGCTG-3′;

Wnt10b: 5′-GAGTGCAAGGTTACAGAGTGGG-3′ and

5′-TCAGAGCAAAGGGCTGAAAAGG-3′;

Wnt16: 5′-CTACAGCTCCCTGCAAACGA-3′;

β-actin: 5′-GAGCACAGAGCCTCGCCTTT-3′and

5′-ACATGCCGGAGCCGTTGTC-3′.

Lin Y.C., Haas A., Bufe A., Parbin S., Hennecke M., Voloshanenko O., Gross J., Boutros M., Acebron S.P, & Bastians H. (2020). Wnt10b-GSK3β–dependent Wnt/STOP signaling prevents aneuploidy in human somatic cells. Life Science Alliance, 4(1), e202000855.

+ Open protocol

+ Expand

Quantitative RNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNAs were extracted with Trizol reagent (Invitrogen) and subjected to oligo (dT)-primed reverse transcription using the PrimeScript RT reagent Kit. The quantitative PCR was performed using an Applied Biosystems 7,300 Real-Time PCR System. All reactions were performed in triplicate. GAPDH served as an internal control.

Li T., Chen L., Cheng J., Dai J., Huang Y., Zhang J., Liu Z., Li A., Li N., Wang H., Yin X., He K., Yu M., Zhou T., Zhang X, & Xia Q. (2016). SUMOylated NKAP is essential for chromosome alignment by anchoring CENP-E to kinetochores. Nature Communications, 7, 12969.

+ Open protocol

+ Expand

Quantifying HOTAIR and NANOG Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from the burnt skin tissue of 12 mice and the ESCs using TRIzol^® reagent (Invitrogen; Thermo Fisher Scientific, Inc.). Total RNA (1 µg) was converted into first strand complementary (c)DNA using a RT reagent kit (Invitrogen; Thermo Fisher Scientific, Inc.) at 42°C for 1 h according to the manufacturer's instructions. The conditions of qPCR using the SYBR Premix Ex Taq kit (Takara Bio, Inc.) were as follows: Initial denaturation for 5 min at 95°C, then 40 cycles of denaturation at 94°C for 30 sec, annealing for 30 sec at 56°C, and elongation for 25 sec at 72°C. The primer sequences used were as follows: HOTAIR forward, 5′-GGTAGAAAAAGCAACCACGAAGG-3′ and reverse, 5′-ACATAAACCTCTGTCTGTGAGTGCC-3′; NANOG forward, 5′-CCGTTGGGCTGACATGAGCGT-3′ and reverse, 5′-GGCAGGCATCGGCGAGGAAT-3′; and GAPDH forward, 5′-AGAAGGCTGGGGCTCATTTG-3′ and reverse, 5′-AGGGGCCATCCACAGTCTTC-3′. GAPDH was used to normalized HOTAIR and NANOG levels. The 2^−ΔΔCq method was used to evaluate the relative expression of mRNA (35 (link)).

Shi Y., Yang R., Tu L, & Liu D. (2020). Long non-coding RNA HOTAIR promotes burn wound healing by regulating epidermal stem cells. Molecular Medicine Reports, 22(3), 1811-1820.

+ Open protocol

+ Expand

Quantifying Immune Cell Markers in CD8+ T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total mRNA was extracted from CD8+ T cells with different treatments using TRIZOL reagent (Cat. 15596-026, Invitrogen, Waltham, MA, USA), and cDNA was generated from 1 μg of RNA using an RT reagent kit (Cat. k1622, Thermo Fisher Scientific). Real-time PCR was performed using the Bio-Rad CFX96 Detection System (Bio-Rad Laboratories, Hercules, CA, USA) with SYBR Green (Cat.1725121, Bio-Rad Laboratories). All reactions were run in triplicate, and relative gene expression was calculated using the comparative threshold cycle (Ct) method (relative gene expression = 2−(ΔCtsample−ΔCtcontrol)). The gene-specific primers used were forward 5′- CGGTGTCGTGTGGAACAATA -3′ and reverse 5′-TCATCATCCCAGCCGTAGTC -3′ for Prf1; forward 5′- GACCCAGCAAGTCATCCCTA -3′ and reverse: 5′- CCAGCCACATAGCACACATC -3′ for GzmB; forward 5′-TGATCCTTTGGACCCTCTG-3′ and reverse 5′- ACAGCCATGAGGAAGAGCTG -3′ for Ifng; and forward 5′-AGCCATGTACGTAGCCATCC-3′ and reverse 5′-CTCTCAGCTGTGGTGGTGAA-3′ for β-actin. The relative expression levels of mRNAs were normalized by the level of β-actin expression in each sample.

Zhang H., Wang Y., Onuma A., He J., Wang H., Xia Y., Lal R., Cheng X., Kasumova G., Hu Z., Deng M., Beane J.D., Kim A.C., Huang H, & Tsung A. (2021). Neutrophils Extracellular Traps Inhibition Improves PD-1 Blockade Immunotherapy in Colorectal Cancer. Cancers, 13(21), 5333.

+ Open protocol

+ Expand

Quantitative mRNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total mRNA was extracted from liver or cells using TRIZOL reagent (Cat. 15596–026, Invitrogen, USA), and cDNA was generated from 1 μg of RNA using an RT reagent kit (Cat. k1622, Thermo Fisher Scientific, USA). Real-time PCR was performed using the Bio-Rad CFX96 Detection System (Bio-Rad Laboratories, USA) with SYBR-green (Cat.1725121, Bio-Rad, USA). All reactions were run in triplicate, and relative gene expression was calculated using the comparative threshold cycle (Ct) method (relative gene expression = 2−(ΔCtsample-ΔCtcontrol)). The gene-specific primers used were forward 5′- GCGAACGCTGCCACTCA −3′ and reverse 5′-ATCCCAGGCTTGGAAGGTC-3′ for Irg1, and forward 5′-AGCCATGTACGTAGCCATCC-3′ and reverse: 5′-CTCTCAGCTGTGGTGGTGAA-3′ for β-actin. The relative expression level of mRNAs was normalized by the level of β-actin expression in each sample.

Zhang H., Chen T., Ren J., Xia Y., Onuma A., Wang Y., He J., Wu J., Wang H., Hamad A., Shen C., Zhang J., Asara J.M., Behbehani G.K., Wen H., Deng M., Tsung A, & Huang H. (2021). Preoperative exercise therapy triggers anti-inflammatory trained immunity of Kupffer cells through metabolic reprogramming. Nature metabolism, 3(6), 843-858.

+ Open protocol

+ Expand

qRT-PCR Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The leaves of the s₁ homozygous plants and transformable receptor plants were sampled, and total RNA was extracted using a Quick-RNA isolation kit (Huayueyang Biotechnology). cDNA was synthesized with a reverse transcription (RT) reagent kit (Invitrogen) according to the manufacturer’s instructions. qRT-PCR was conducted on a CFX96 real-time system (Bio-Rad) with a TB Green RT-PCR kit (Takara). Relative gene expression levels were calculated according to the 2^–ΔΔCt relative quantification method with maize ACTIN (Zm00001d010159) as the internal control (Livak and Schmittgen, 2001 (link)).

Meng D., Luo H., Dong Z., Huang W., Liu F., Li F., Chen S., Yu H, & Jin W. (2022). Overexpression of Modified CENH3 in Maize Stock6-Derived Inducer Lines Can Effectively Improve Maternal Haploid Induction Rates. Frontiers in Plant Science, 13, 892055.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!