S. pneumoniae ATCC49619 was cultured into brain heart infusion (BHI) broth (HiMedia, India) and incubated at 37°C for 24 h. Then, 2 mL from overnight culture was sub-cultured into 50 BHI broth and incubated at 37°C for 4 h. The medium was subsequently centrifuged at 9000 rpm for 3 minutes. The supernatant proteins were then precipitated using acetone precipitation method and the results were electrophoresed on 10% polyacrylamide gel. The concentration of supernatant proteins was also measured by spectrophotometry method using Nano drop instrument with following formula: (Protein concentration (mg/ml) = 1.55A280 – 0.75A260).
Bhi broth
Manufactured by HiMedia
Sourced in India
BHI broth is a general-purpose microbiological culture medium used for the growth and cultivation of a wide range of microorganisms, including bacteria, yeast, and fungi. It provides the necessary nutrients and growth factors to support the proliferation of a diverse range of microbial species.
Automatically generated - may contain errors
Lab products found in correlation
Bhi agar, by HiMedia (5 mentions)
Phosphate buffered saline (pbs), by HiMedia (2 mentions)
Blood agar media, by HiMedia (2 mentions)
King s b kb media, by HiMedia (2 mentions)
Mueller hinton media, by HiMedia (2 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Mini cycler, by Bio-Rad (1 mentions)
Den 1 mcfarland densitometer, by Biosan (1 mentions)
Rotina 420r, by Hettich (1 mentions)
Gp cones, by Dentsply (1 mentions)
Api 20c aux kit, by bioMérieux (1 mentions)
Pipes buffer, by Merck Group (1 mentions)
Sodium chloride (nacl), by Vetec (1 mentions)
Mitis salivarius agar, by HiMedia (1 mentions)
Bacitracin, by HiMedia (1 mentions)
Mrs broth, by HiMedia (1 mentions)
Minisart syringe filter, by Sartorius (1 mentions)
Nanodrop model nd 1000, by Thermo Fisher Scientific (1 mentions)
Crystal violet, by HiMedia (1 mentions)
64 protocols using bhi broth
1
Proteomic Analysis of S. pneumoniae
2
Bacterial Adhesion on Pierced Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Samples were divided into two groups according to the type of solution, where each group had 96 previously autoclaved piercings, 24 of each type. Of these, 20 of each type were used for bacterial adhesion test and 4 for SEM analysis. The first group (S1) showed 96 test tubes containing 5 mL of BHI broth (Brain Heart Infusion, HIMEDIA®, Mumbai, India) and 50 μL of bacterial inoculum and the second group (S2) had 96 test tubes containing 5 mL BHI broth serving as sterility control of the culture medium and samples. After placement of piercing with the aid of sterile tweezers, the tubes were incubated in bacteriological incubator at 37°C in microaerophilic conditions for a period of 24 hours.
3
Pathogenic Bacteria Cultivation and Storage
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All the bacteria were received from Bacterial laboratory, School of Allied Health Sciences, Walailak University, Thailand. Important pathogenic bacteria including Acinetobacter baumannii ATCC 3476, E. coli ATCC 25922, E. coli DMST 4112, E. coli O157:H7 DMST 2743, Listeria monocytogenes DMST 73303, Salmonella Enteritidis DMST 15676, S. aureus ATCC 25923, MRSA, and Staphylococcus epidermidis DMST 25505 were used for the experiments. The pathogens were cultured in brain heart infusion (BHI) broth (HiMedia, India), incubated at 37°C for 18 h, and stored in BHI broth containing 25% (v/v) glycerol at −80°C until further use.
4
Impact of Salinity and Shaking on Vibrio Virulence
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
V. parahaemolyticus XN9 was optimally maintained and preserved in Brain Heart Infusion (BHI) medium with 2.5% NaCl, 30 o C, pH 8.5 and 120 rpm (Anh et al., 2018) . This condition (2.5% NaCl, 30 o C, pH 8.5, 120 rpm) was applied in this study as standard condition to determine the effect of different salinity and shaking condition on the virulence factors of V. parahaemolyticus.
To examine the effect of salinity, a single colony of V. parahaemolyticus XN9 was inoculated into BHI broth (Himedia, India) having different salt concentrations, 2.0, 2.5 and 3.0% and incubated overnight, 120 rpm at 30 o C. In the next day, the bacteria suspension was used to inoculate BHI broth with corresponding salt concentrations. The starting OD620nm (0h) was adjusted to 0.05 (0h) and the flasks were incubated at 30 o C, 120 rpm and measured each hour for OD620nm and dissolved oxygen (DO) concentration for 8 hours.
To examine the effect of shaking condition, same procedure was carried out on V. parahaemolyticus but instead of varying salinity, salt concentration was kept at 2.5% and shaking conditions was varied between 0, 120 and 240 rpm. The experiments were triplicated.
To examine the effect of salinity, a single colony of V. parahaemolyticus XN9 was inoculated into BHI broth (Himedia, India) having different salt concentrations, 2.0, 2.5 and 3.0% and incubated overnight, 120 rpm at 30 o C. In the next day, the bacteria suspension was used to inoculate BHI broth with corresponding salt concentrations. The starting OD620nm (0h) was adjusted to 0.05 (0h) and the flasks were incubated at 30 o C, 120 rpm and measured each hour for OD620nm and dissolved oxygen (DO) concentration for 8 hours.
To examine the effect of shaking condition, same procedure was carried out on V. parahaemolyticus but instead of varying salinity, salt concentration was kept at 2.5% and shaking conditions was varied between 0, 120 and 240 rpm. The experiments were triplicated.
5
Monotypic Biofilm Formation Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After the screening promoted by the broth microdilution test, only the extracts that obtained MMC into the interval tested were selected for monotypic biofilm tests: H. virginiana, J. regia, P. americana, P. paniculata, and R. officinalis.
Initially, the K. pneumoniae strains were cultured in BHI broth (Himedia, Mumbai, India) at 37 °C/24 h. After incubation, the microorganism suspension was centrifuged at 2000 rpm/10 min (MPW-350, Warsaw, Poland) and washed twice with 0.9% saline solution for the removal of the microorganisms metabolites. The turbidity of the suspensions was adjusted in a spectrophotometer (Micronal) at a concentration of 10 7 CFU/mL. The microorganism suspension was distributed into 96-well plates with N=10 for each group, then 100 μL/well of BHI broth (Himedia, Mumbai, India) was added and the plate was incubated at 37 °C for 48h, under constant stirring (75 rpm).
Initially, the K. pneumoniae strains were cultured in BHI broth (Himedia, Mumbai, India) at 37 °C/24 h. After incubation, the microorganism suspension was centrifuged at 2000 rpm/10 min (MPW-350, Warsaw, Poland) and washed twice with 0.9% saline solution for the removal of the microorganisms metabolites. The turbidity of the suspensions was adjusted in a spectrophotometer (Micronal) at a concentration of 10 7 CFU/mL. The microorganism suspension was distributed into 96-well plates with N=10 for each group, then 100 μL/well of BHI broth (Himedia, Mumbai, India) was added and the plate was incubated at 37 °C for 48h, under constant stirring (75 rpm).
6
Antibacterial Effects of GIC Specimens
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The antibacterial effects of the set specimens against SM and Lactobacillus casei were assessed in vitro by agar diffusion test. Five specimens were prepared for each of the three groups. P/L ratio 3.6:1 of each GIC was dispensed on the mixing pad and mixed for 30 s with sterile plastic spatula and placed into steel mold of dimension 10 mm diameter and 2 mm thickness. The material was allowed to set for 30 min at room temperature and then removed. All specimens were then sterilized with UV before the subsequent procedure. Each strain from the stock culture stored in 50% glycerol at -20° was cultivated in brain heart infusion (BHI) broth (Hi-Media Laboratories Pvt. Ltd.) at 37°C, and a loopful of inoculum was transferred to 10 ml of BHI broth after incubation for 48 h. Bacterial suspension of 300 µl was then spread on BHI plate and left for 30 min at room temperature. The set disc-shaped specimens were placed onto BHI plate, inoculated with bacterial strain and left at 37°C for 48 h. The zones of inhibition were measured in millimeters using a digital caliper at three different points. The sizes of the inhibition zones were calculated by subtracting the diameter of the specimen, 10 mm, from the average of the three measurements of the halo.
7
Isolation and Identification of Staphylococcus aureus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Isolation and identification of S. aureus was done as per the procedure mentioned in ISO standard 6888/ 1:1999 and 6888/2: 1999. Initially enrichment of S. aureus from meat sample was done in buffered peptone water followed by second enrichment in Brain Heart Infusion (BHI) broth (HiMedia) supplemented with 6% Sodium chloride. Selective plating of the culture from BHI broth was done on Mannitol salt agar (HiMedia) and Baird-parker agar (HiMedia). The plates were incubated for 24 hours at 37 °C and randomly selected single colonies were used for biochemical analysis for confirmation. The confirmation of the isolates was based on the following tests: -indole, methyl red, Voges-Proskauer, citrate utilization, urease activity and ONPG.
8
Culturing and Harvesting GBS Strains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
S. agalactiae strains isolated from fishes were thawed, streaked onto 5% sheep blood agar and incubated at 28 °C for 48 h according to the method described by Godoy et al. [10 (link)]. The NEM316 strain was incubated at 37 °C for 24 h according to the method described by Pereira et al. [32 (link)]. Each strain was inoculated into BHI broth (“Brain Heart Infusion”, Himedia, Mumbai, India) containing 0.05% (v/v) Tween 80 (BHIT) and cultured at 30 °C with gently agitation. Biological triplicate cultures of each strain were harvested for protein isolation upon reaching absorbances of 0.2 and 0.5 (OD600), equivalent to the mid-exponential phase of bacterial growth of the fish-adapted GBS strains (data not shown) and the NEM316 strain [30 (link)], respectively. The GBS strains were cultured under laboratory conditions at 30 °C; this corresponds to the temperature at which increased outbreaks of streptococcosis normally occur in fishes [4 (link)].
9
Antimicrobial Screening of P. gingivalis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The periodontopathic bacterial strains P. gingivalis ATCC33277 obtained from NCIM, Pune, was grown in half-strength brain heart infusion (BHI) broth (HiMedia Laboratories, USA) supplemented with 5 mg/mL yeast, 5 μg/mL hemin, and 1 μg/mL vitamin K1 (BHI-HK). The bacteria are grown at 37°C anaerobically (85% N2, 10% H2, and 5% CO2). The disc diffusion method[5 (link)] was used to screen the antimicrobial activity. The antimicrobial activity was determined using half-strength BHI agar in which 5% defibrinated sheep blood was supplemented, and the optical density (OD) of the bacterial inocula was adjusted to 0.1 at 600 nm (0.5 McFarland standard). The bacterial inoculum suspension (100 μL) was swabbed uniformly on a blood agar plate, and the plate was allowed to dry for 5 min. Various concentrations of extracts (2.5, 5, 10, and 20 mg/mL) were loaded at 20 μL onto a 6 mm sterile disc (50, 100, and 200 μg/disc, respectively). The disc loaded with extracts was placed on the surface of the medium, the compound loaded was allowed to diffuse for 5 min, and the plates were incubated at 37°C for 48 h. At the end of the incubation, the inhibition zones formed around the loaded disc were measured with a transparent ruler in millimeter units. This experimental study was performed in triplicate.
10
Molecular Identification of Streptococcal Serotypes
Check if the same lab product or an alternative is used in the 5 most similar protocols
emm typing is based on sequence analysis of emm gene encoding for serotype specific M-protein. Genomic DNA was prepared by phenol-chloroform method [29 ] from bacteria obtained by touching the tips of β-hemolytic single colonies, obtained by subculture from overnight broth culture (BHI broth, Hi-media, Mumbai, India), to avoid contamination in growth in liquid medium. Bacterial cells were treated with mutanolysin and lysozyme solution for 1 h at 37 °C. For emm typing analysis, gene was amplified by “all M” primers [15 (link), 30 (link)], using PTC150 (MiniCyclerTM, MJ Research) thermal cycler. PCR amplicon of about 1.4 kb was then sequenced with the forward primer (5′ ATAAGGAGCATAAAAATGGCT 3′). Sequencing was done commercially (Chromous Biotech Pvt. Ltd., India). The sequence was subjected to homology search by Blast search analysis (http://www.cdc.gov/ncidod/biotech/strep/ strepblast.htm). Pair-wise comparison of the nucleotide identities of the first 180 to 200 bases of the N-terminal hypervariable region was conducted and strains which showed ≥ 95% homology with the reference strains were assigned the particular parental emm type [15 (link)].
+ Expand
emm typing is based on sequence analysis of emm gene encoding for serotype specific M-protein. Genomic DNA was prepared by phenol-chloroform method [29 ] from bacteria obtained by touching the tips of β-hemolytic single colonies, obtained by subculture from overnight broth culture (BHI broth, Hi-media, Mumbai, India), to avoid contamination in growth in liquid medium. Bacterial cells were treated with mutanolysin and lysozyme solution for 1 h at 37 °C. For emm typing analysis, gene was amplified by “all M” primers [15 (link), 30 (link)], using PTC150 (MiniCyclerTM, MJ Research) thermal cycler. PCR amplicon of about 1.4 kb was then sequenced with the forward primer (5′ ATAAGGAGCATAAAAATGGCT 3′). Sequencing was done commercially (Chromous Biotech Pvt. Ltd., India). The sequence was subjected to homology search by Blast search analysis (
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!