Total RNA was isolated from the colonic tissues with TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). Total RNA (4 µg) was reverse-transcribed using oligo(dT) primer (Applied Biosystems, Branchburg, NJ, USA), and RT-qPCR was performed using a 7900H Fast Real-Time PCR System (Applied Biosystems) as described previously (12 (link)). The set of primers for mouse IL-4, IL-6, IL-10, IL-12, IFN-γ and glyceraldehydes-3-phosphate dehydrogenase (GAPDH) were prepared as shown in Table I . RT-qPCR assays were carried out with 200 ng of RNA equivalent cDNA, SYBR-Green Master Mix (Applied Biosystems), and 500 nmol/l gene-specific primers. The PCR cycling conditions were 50°C for 15 sec and 60°C for 60 sec. The intensity of the fluorescent dye was determined, and the expression levels of target gene mRNA were normalized to the expression level of GAPDH mRNA.
7900h fast real time pcr system
Manufactured by Thermo Fisher Scientific
Sourced in United States, Finland
The 7900H Fast Real-Time PCR System is a high-performance real-time PCR instrument designed for rapid and accurate nucleic acid analysis. It features a compact design, flexible sample capacity, and advanced thermal cycling technology to enable efficient and reliable gene expression studies, genotyping, and other real-time PCR applications.
Automatically generated - may contain errors
Lab products found in correlation
Sybr green master mix, by Thermo Fisher Scientific (6 mentions)
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Oligo dt primer, by Thermo Fisher Scientific (5 mentions)
Dynamo flash sybr green qpcr kit, by Thermo Fisher Scientific (2 mentions)
Mmlv rt reagent kit, by Thermo Fisher Scientific (2 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Power sybr master mix, by Thermo Fisher Scientific (2 mentions)
Purelink rna mini kit, by Thermo Fisher Scientific (2 mentions)
Lightcycler 480, by Roche (1 mentions)
Rneasy extraction kit, by Qiagen (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Brilliant 2 sybr green qpcr master mix, by Agilent Technologies (1 mentions)
Taqman 2 pcr master mix, by Thermo Fisher Scientific (1 mentions)
Isolate rna mini kit, by Meridian Bioscience (1 mentions)
Affinityscript qpcr cdna synthesis kit, by Agilent Technologies (1 mentions)
Superscript 2 reverse transcriptase first strand synthesis kit, by Thermo Fisher Scientific (1 mentions)
14 protocols using 7900h fast real time pcr system
1
Quantitative RT-PCR Analysis of Cytokine Expression
2
Quantifying Proglucagon and GPR43 mRNA in GI Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from GI tissues with Trizol reagent (Invitrogen, Carlsbad, CA). Total RNA (4 ug) was reverse-transcribed using oligo-dT primer (Applied Biosystems, Branchburg, NJ), and real-time RT-PCR was performed using 7900 H Fast Real-Time PCR System (Applied Biosystems) as previously described13 (link). The set of primers for mouse proglucagon, GPR43, and GAPDH were prepared as shown in Table 1 . Real-time RT-PCR assays were carried out with 200 ng of RNA equivalent cDNA, SYBR Green Master Mix (Applied Biosystems), and 500 nmol/l gene-specific primers. The PCR cycling conditions were 50 °C for 15 s and 60 °C for 60 s. The intensity of the fluorescent dye was determined, and the expression levels of target gene mRNA were normalized to GAPDH mRNA expression levels.
Primers for real-time RT-PCR analysis.
| Proglucagon | Forward | 5′-TGAGATGAGCACCATTCTGGA-3′ |
| Reverse | 5′-TCCGCAGAGATGTTGTGAAGA-3′ | |
| GPR43 | Forward | 5′-ACAGTGGAGGGGACCAAGAT-3′ |
| Reverse | 5′-GGGGACTCTCTACTCGGTGA-3′ | |
| GAPDH | Forward | 5′-GGAGAAACCTGCCAAGTATG-3′ |
| Reverse | 5′-TGGGAGTTGCTGTTGAAGTC-3′ |
3
Quantitative PCR Workflow for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction was performed using the RNeasy extraction kit (Qiagen) following manufacturers procedure. For blood samples, Trizol (Ambion, Life technologies) lysis was performed before kit purification. High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) was used for the cDNA preparation. Quantitative PCR was performed using the LightCycler480 (Roche) using SYTO9 as a dye and the 2-ΔCt method to analyze expression difference [55 (link)]. Q-PCR PyMT in blood was detected using the following primers: Fwd: tgtgcacagcgtgtataatcc and Rv: tcatcgtgtagtggactgtgg; and confirmed with Fwd: taagaaggctacatgcggatgggt and Rv: ggcacctggcatcacatttgtctt; and housekeeping gene GAPD using the following primers Fwd: agcttgtcatcaacgggaag; and Rv: tttgatgttagtggggtctcg. Q-PCR for Elf5 was detected using Taqman probe Mm00468732_m1 or Hs01063022_m1 (Applied Biosystems), and housekeeping gene GAPD, Mm99999915_g1 or Hs99999905_m1; using the 7900H Fast Real-Time PCR system (Applied Biosystems).
4
Quantification of Hepatic Gene Expression
5
Real-Time RT-PCR Analysis of Intestinal Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the small-intestinal tissues with TRIzol reagent (Invitrogen, Waltham, MA, USA). Four micrograms of total RNA was reverse-transcribed using an oligo (dT) primer (Applied Biosystems, Branchburg, NJ, USA), and real-time RT-PCR was carried out using a 7900H Fast Real-Time PCR System (Applied Biosystems) as previously described [8 (link)]. The set of primers used is shown in Supplementary Table S2 . Real-time RT-PCR assays were carried out with 200 ng of RNA-equivalent cDNA, SYBR Green Master Mix (Applied Biosystems) and 500 nmol/l gene-specific primers. The PCR cycling conditions were 50 °C for 15 s and 60 °C for 60 s. The intensity of the fluorescent dye was determined, and the expression levels of target gene mRNAs were normalized to those of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA.
6
Quantitative Analysis of Inflammatory Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the colonic tissues with TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). Total RNA (2 µg) was reverse-transcribed using oligo-dT primer (Applied Biosystems, Branchburg, NJ, USA), and real-time reverse transcription-polymerase chain reaction (RT-PCR) was performed using a 7900H Fast Real-Time PCR System (Applied Biosystems) as described previously [14 (link)]. The set of primers for rat IL-1β, IL-6, IL-18, IFN-γ, TNF-α, ZO-1, occludin, claudins, and glyceraldehydes-3-phosphate dehydrogenase (GAPDH) were prepared as shown in Table 1 . Real-time PCR assays were performed using 100 ng of RNA equivalent cDNA, SYBR-Green Master Mix (Applied Biosystems) and 500 nmol/L gene specific primers. The PCR cycling conditions were 95 °C for 15 s and 60 °C for 60 s. The intensity of the fluorescent dye was determined, and the expression levels of target genes mRNA were normalized to the expression level of GAPDH mRNA.
7
Quantifying mRNA Levels in pMEFs and Embryos
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To quantify Ptch1 mRNA levels in pMEFs, RNA was extracted using the RNeasy mini kit (QIAGEN) and cDNA synthesis performed using the AffinityScript QPCR cDNA Synthesis kit (Agilent Technologies) according to the manufacturer’s instructions. Quantitative RT-PCR was performed on the 7900H Fast Real-Time PCR system (Applied Biosystems) using TaqMan 2× PCR MasterMix and Ptch1 and Actb TaqMan probes (Applied Biosystems). Each sample was analyzed in triplicate and normalized to Actb expression.
To quantify Gli1 mRNA levels in pMEFs and Ptch1 levels in E10.5 embryos, RNA was isolated using the Isolate RNA mini kit (Bioline) and cDNA synthesis performed using the AffinityScript QPCR cDNA Synthesis kit (Agilent Technologies) according to manufacturer’s instructions. Quantitative RT-PCR was performed on a Rotor-Gene 3000-qRT-PCR machine using Brilliant II SYBR Green qPCR Master Mix (Agilent Technologies) and GLI1, Ptch1, and Gapdh primers (QIAGEN). Each sample was analyzed in triplicate and normalized to Gapdh expression.
To quantify Gli1 mRNA levels in pMEFs and Ptch1 levels in E10.5 embryos, RNA was isolated using the Isolate RNA mini kit (Bioline) and cDNA synthesis performed using the AffinityScript QPCR cDNA Synthesis kit (Agilent Technologies) according to manufacturer’s instructions. Quantitative RT-PCR was performed on a Rotor-Gene 3000-qRT-PCR machine using Brilliant II SYBR Green qPCR Master Mix (Agilent Technologies) and GLI1, Ptch1, and Gapdh primers (QIAGEN). Each sample was analyzed in triplicate and normalized to Gapdh expression.
8
Quantitative PCR Analysis of RCC Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from RCC cells and frozen RCC tumor tissues. cDNA was synthesized from RNA using a MMLV RT Reagent Kit (Thermo Fisher Scientific Inc.). The DyNAmo Flash SYBR Green qPCR kit (Finnzymes Oy, Espoo, Finland) was used and analyzed on the 7900H Fast Real-Time PCR System (Applied Biosystems) according to the manufacturer’s instructions. For RT-PCR, primers targeting the Ror2 (left: 5′-TTTCAGGATGATTACCACGAG-3′, right: 5′-CTCACACTTGGGCAGCTGAA-3′), PCNA (left: 5′-GGTGTTGGAGGCACTCAAGG-3′, right: 5′-CAGGGTGAGCTGCACCAAAG-3′), CDK1 (left: 5′-ACCATACCCATTGACTAAC-3′, right: 5′-ATAAGCACATCCTGAAGAC-3′), TWIST (left: 5′-AGTCCGCAGTCTTACGAG-3′, right: 5′-GCTTGCCATCTTGGAGTC-3′), MMP-2 (left: 5′-TTGACGGTAAGGACGGACTC-3′, right: 5′-GGCGTTCCCATACTTCACAC-3′), and GAPDH (left: 5′-CACCCACTCCTCCACCTTTG-3′, right: 5′-CCACCACCCTGTTGCTGTAG-3′) were generated. Relative quantification of mRNA expression levels was determined using the 2−ΔΔCt method.
9
Colonic RNA Extraction and qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from the colonic tissues with TRIzol reagent (Invitrogen, Waltham, MA, USA). Total RNA (4 µg) was reverse-transcribed using an oligo (dT) primer (Applied Biosystems, Branchburg, NJ, USA), and real-time RT-PCR was carried out using a 7900H Fast Real-Time PCR System (Applied Biosystems) as described previously [23 (link)]. The primers used are shown in Supplementary Table S1 . Real-time RT-PCR assays were performed with 200 ng of RNA-equivalent cDNA, SYBR-Green Master Mix (Applied Biosystems), and 500 nmol/L gene-specific primers. The PCR cycling conditions were 50 °C for 15 s and 60 °C for 60 s. The intensity of the fluorescent dye was determined, and the expression levels of target gene mRNA were normalized to the expression level of glyceraldehydes-3-phosphate dehydrogenase (GAPDH) mRNA.
10
Quantitative RT-PCR Analysis of MMP and IL-22
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time reverse transcription-polymerase chain reaction (RT-PCR) was performed using 7900H Fast Real-Time PCR System (Applied Biosystems) as previously described (Sekikawa et al, 2010 (link)). The following sets of primers for human matrix metalloproteinase 7 (MMP7), MMP13, IL-22, IL-22R1, and GAPDH, were prepared (Supplementary Table 2 ). Real-time RT-PCR assays were carried out with 200 ng RNA equivalent cDNA, SYBR Green Master Mix (Applied Biosystems), and 500 nmol l−1 gene-specific primers. The PCR cycling conditions were 50 °C for 15 s and 60 °C for 60 s. The intensity of the fluorescent dye was determined, and each of mRNA expression levels was normalised to GAPDH mRNA expression levels.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!