Axiocam hrc color microscope camera

Manufactured by Zeiss

The AxioCam HRc is a high-resolution color microscope camera designed for scientific imaging and documentation. It features a 1.4-megapixel CCD sensor and supports various image resolutions and frame rates. The camera is capable of capturing high-quality color images and is suitable for a range of microscopy applications.

Automatically generated - may contain errors

Lab products found in correlation

Axioskop microscope, by Zeiss (1 mentions) Prism 5, by GraphPad (1 mentions) Axio zoom v16 stereomicroscope, by Zeiss (1 mentions) Plan apochromat 63 1.4 oil immersion objective, by Zeiss (1 mentions) Lsm 700 inverted confocal microscope, by Zeiss (1 mentions)

Close spelling variants of this product

AxioCam HRC color camera AxioCam HRc microscope camera Axiocam HRc color AxioCam HRc camera AxioCam HRc microscope Axiocam color camera AxioCam HRc AxioCam microscope camera AxioCam camera AxioCam microscope

2 protocols using axiocam hrc color microscope camera

Quantitative Analysis of Histological Staining

Check if the same lab product or an alternative is used in the 5 most similar protocols

Light microscopic images were captured with a TOCO digital slide scanner or an Axioskop microscope (Zeiss) equipped with an AxioCam HRc color microscope camera (Zeiss). Quantification of the stained area, basement membrane length, and band intensity was performed using ImageJ software (National Institute of Health, Bethesda, MD, USA). For Alcian blue- and Masson’s trichrome-stained samples, the blue-stained regions were selected using the magic wand tool in PhotoShop CS5 software (Adobe Systems, San Jose, CA, USA) and converted to black with ImageJ software. The pixel area of the black region was quantified with ImageJ software. The volume of epithelial mucus was calculated by multiplying the blue stained area by the thickness of the section. Data are presented as the mean ± SEM of at least three independent experiments. A student’s t test or one-way ANOVA followed by a Tukey’s post-hoc test was performed for the statistical analysis of data using GraphPad Prism 5 software (GraphPad Software, San Diego, CA, USA). A value of p < 0.05 was considered significant.

Kubo F., Ariestanti D.M., Oki S., Fukuzawa T., Demizu R., Sato T., Sabirin R.M., Hirose S, & Nakamura N. (2019). Loss of the adhesion G-protein coupled receptor ADGRF5 in mice induces airway inflammation and the expression of CCL2 in lung endothelial cells. Respiratory Research, 20, 11.

+ Open protocol

+ Expand

Xenopus and Sea Urchin Enkurin Localization

Check if the same lab product or an alternative is used in the 5 most similar protocols

Embryos dejellied in 1/3X modified Marc’s Ringer (MMR) with 2.5%(W/V) cysteine at pH7.8 and were microinjected with mRNA or morpholino in 2% Ficoll (W/V) in 1/3X MMR at the 4 cell stage. Injected embryos were washed and were incubated in 1/3X MMR until the appropriate stages.
For expression of X. laevis and S. purpuratus ENKUR-GFP, capped mRNA was synthesized using mMESSAGE mMACHINE SP6 transcription kit (Invitrogen Ambion). A morpholino antisense oligonucleotide (MO) against Enkurin was designed to block splicing (Gene Tools). Its sequence was 5′- AATGACTATCCACTTACTTTCAGCC - 3′. mRNA and MOs were injected into two ventral blastomeres or two dorsal blastomeres at the 4-cell stage to target the epidermis or the gastrocoel roof plate (GRP), respectively. Each mRNA or MO was used at the following dosages: GFP-Enkurin (60 pg), centrin4-BFP (40 pg), memRFP (50 pg) and Enkurin MO (20 ng). To verify the efficiency of Enkurin MO, MO was injected into the all cells at 4-cell stage and then RT-PCR was performed as described in the “Quantitative RT-PCR” section of the STAR methods.
Confocal images were captured with LSM700 inverted confocal microscope (Carl Zeiss) with a Plan-APOCHROMAT 63×/1.4 oil immersion objective. Bright field images were captured on a Zeiss Axio Zoom. V16 stereo microscope with Carl Zeiss Axiocam HRc color microscope camera.

Sigg M.A., Menchen T., Lee C., Johnson J., Jungnickel M.K., Choksi S.P., Garcia G 3.r.d., Busengdal H., Dougherty G., Pennekamp P., Werner C., Rentzsch F., Florman H.M., Krogan N., Wallingford J.B., Omran H, & Reiter J.F. (2017). Evolutionary proteomics uncovers ancient associations of cilia with signaling pathways. Developmental cell, 43(6), 744-762.e11.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!