Faststart universal sybr green
FastStart Universal SYBR Green is a ready-to-use master mix for real-time PCR amplification. It contains FastStart Taq DNA Polymerase, SYBR Green I dye, and optimized buffer components.
Lab products found in correlation
54 protocols using faststart universal sybr green
Quantitative Real-Time PCR of Foxtail Millet
Quantifying Scavenger Receptor A Expression
Quantitative Analysis of miR-1296-5p and STAT1 mRNA
miRNA-142-3p Quantification by qRT-PCR
Primers Used for qRT-PCR
Gene | Primer Sequence |
---|---|
U6 | Forward: 5’- CTCGCTTCGGCAGCACA - 3’ |
Reverse: 5’- AACGCTTCACGAATTTGCGT - 3’ | |
MiR-142-3p | 5’- GCGCGTGTAGTGTTTCCTACTTTATGG - 3’ |
RNA Isolation and RT-PCR Analysis
qRT-PCR Analysis of Gene Expression
Quantitative Real-Time PCR Protocol
Real-time RT-PCR Analysis of Mouse Brain
ChIP-qPCR Analysis of Transcription Factors
Quantitative Analysis of Rat Gene Expression
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!