Stbl3 cells

LentiGuide-Puro was digested with BsmBI and purified by gel extraction (Macherey-Nagel). Single stranded oligos (Sigma) containing the guide sequence and 25nt overlap with digested LentiGuide-Puro on each side (Supplementary Table 1) were cloned with the Gibson cloning kit (NEB). Chemo-competent Stbl3 cells (Thermofisher) were transformed with the Gibson products by heat shock. Upon minipreps (Macherey-Nagel), the plasmids were verified by Sanger sequencing (ABI).

Peripheral blood, bone marrow, and unused CD34⁺ hematopoietic stem cells from autologous transplant products were obtained from MM and/or plasma cell leukemia patients or healthy donors.
Cell lines U-266, RPMI-8226, 293T, and K562 cells were obtained from ATCC and cultured according to manufacturer’s instructions. Competent bacteria TG1, BL21[DE3], and DH5α were obtained from Lucigen, Stbl3 cells were obtained from Thermo-Fisher.

Bcl2 overexpression vector was generated by cloning Bcl2 cDNA (Transomic Technologies, Cat. TCM1304) into the pMSCV-loxp-dsRed-loxP-eGFP-puro-WPRE vector (Addgene #32702) using the EcoRI and NsiI restriction sites. Ankle2 cDNA (Transomic Technologies, Cat. TCM1004) was cloned into the MSCV-IRES-Thy1.1 vector using NEBuilder Hifi Assembly (New England Biolabs). All vectors were propagated in Stbl3 cells (ThermoFisher Scientific).

A panel of five sgRNAs targeting the putative Kiss1 enhancer site 1 was designed and cloned. The sgRNAs were designed using an online tool (https://www.deskgen.com/) searching for the PAMs NNGRRT and NNGRR^{36 (link)}. Following phosphorylation and annealing of each oligonucleotide set, the double-stranded products were digested with BsaI (Eco31I), and ligated into the BsaI site of AAV-dSaCas9-KRAB-3xHA-U6::Bsa1-sgRNA. After treatment with Plasmid Safe DNA exonuclease (Epicentre, Madison, WI), 2 µl of each reaction were used to transform Stbl3 cells (ThermoFisher). The next day, colonies were collected and grown overnight for DNA extraction and sequencing. The identity of all sgRNAs was confirmed by sequencing using a primer (Supplementary Table 1) complementary to the U6 promoter sequence^{66 (link)}.

cDNA construct generation was previously described in ref. ^{29 (link)}. These sequences were now cloned towards a pLJC5 vector backbone (Lentiviral vector type), using Gibson assembly. For this, PLD3 sequences were first amplified with the Q5 High-Fidelity 2X Master Mix (NEB) and the following primers: ccgtttttggcttttttgttagacgaagcgctagcatgaagcctaaactgatgtaccaggagctgaagg and atgaatactgccatttgtctcgaggtcgagaattctcagagcaggcggcagg. Gibson assembly was carried out with the NEBuilder HiFi DNA Assembly Cloning Kit (NEB), according to the manufacturer’s instructions. After transformation in Stbl3 cells (Thermo Fisher Scientific), constructs were sequenced with the following primers: CGAGTGTGTTTTGTGAAG and CTACTATTCTTTCCCCTGC. For lentiviral production, HEK293T (CRL-3216, ATCC) were co-transfected with the plasmid of interest, a packaging construct (pCMVR8.74) and a VSV-G envelope expressing plasmid (pMD2.G), using FuGENE6 (Promega) according to the manufacturer’s protocol. Particle-containing mediums was collected 24 h after transfection and filtered through a 0.45 µm filters (PALL 4184, VWR). Serial dilutions were made of the viral particles that were added to the cells in a medium containing polybrene (1:1000, H9268, Sigma). After 24 h, puromycin selection was initiated (3 µg/ml, P8833, Sigma). Stable pools were validated by western blot analysis.