The largest database of trusted experimental protocols
Sourced in United States

The GBC-SD is a laboratory instrument designed for the analysis of liquid samples. It provides accurate measurements of sample properties, such as density and specific gravity, to support various scientific and industrial applications. The GBC-SD operates on the principle of electronic density measurement and delivers reliable results in a compact and user-friendly design.

Automatically generated - may contain errors

28 protocols using gbc sd

1

Culturing Gallbladder Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human GBC cell line GBC-SD was obtained from the Cell Bank of Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China); SGC-996 cells were obtained from Dr. Ying-Bin Liu’s lab at Xin Hua Hospital Affiliated to Shanghai Jiao Tong University School of Medicine (China). NOZ cells were obtained from the HAKATA Cell Bank of the Shanghai Chuanqiu Biotechnology Co., LTD (Shanghai, China). GBC-SD and SGC-996 cell lines were cultured in RPMI‑1640 and NOZ cell lines were cultured in DMEM medium with 10% fetal bovine serum (both from Gibco, Waltham, MA, USA) in a humidified atmosphere containing 5% CO2 at 37 °C. PTS was dissolved in DMSO and diluted in RPMI-1640 or DMEM (with same level of DMSO in controls) to a final value of DMSO < 0.1%.
+ Open protocol
+ Expand
2

Biliary Epithelial Cell Line Culturing

Check if the same lab product or an alternative is used in the 5 most similar protocols
The immortalized human non-tumorigenic biliary epithelial cell line (H69) and GBC cell lines (GBC-SD, NOZ) were used in this study. GBC-SD and H69 were purchased from the cell bank of the Chinese Academy of Science (Shanghai, China). NOZ was purchased from the Health Science Research Resources Bank (Osaka, Japan). GBC-SD was cultured in DMEM high-glucose medium (Gibco, USA), NOZ was cultured in Williams's Medium E (Genom, China) supplemented with 10% fetal bovine serum (Gibco, USA) at 37°C in a humidified incubator with the presence of 5% CO2. Hypoxia (1% O2, 5% CO2 and 94% N2) treatments were carried out in a Forma 0125/1029 Anaerobic Chamber (Thermo Scientific, USA).
+ Open protocol
+ Expand
3

Establishment of GBC and HEK293T Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human GBC cell line GBC-SD and HEK 293 T cells were purchased from the Cell Bank of the Chinese Academy of Sciences. Human GBC cell line NOZ was obtained from Xinhua hospital (Shanghai, China). HEK 293 T and GBC-SD cells were cultivated in RPMI-1640 medium (GibcoBRL, Gaitherburg, MD, USA) supplemented with 10% fetal bovine serum (GIBCO) in an atmosphere consisting of 5% CO2 and 37 °C. Willian’s E medium was used in NOZ cells. The PLEK2 knockdown and overexpression cells were all constructed as stable cell lines. The Flag-tagged PLEK2 were cloned into into pCDH-CMV plasmid (System Biosciences, CA, USA). The PLKE2 shRNA was constructed by Shanghai GenePharma Medical Biotechnology Company. PCDH-flag-PLEK2 sense: 5′- TGCTCTAGAGCAATGGATTACAAGGA TGACGACGATAAGGAGGACGGCGTGCTCAAGGA -3′; PCDH-flag-PLEK2 antisense: 5′- CCGGAATTCCGGTCATGTTAGCTTTTTGATAGCTTCAATC − 3′. The sense sequence of PLEK2 shRNA was: TGCTGAGAGCTACAAAAAG; The sequence of the PLEK2 shRNA was the following: 5′-TGCTGTTGACAGTGAGC GCTTGCTGAGAGCTACAAAAAGATAGTGAAGCCACAGATGTATCTTTTTG TAGCTCTCAGCAAATGCCTACTGCCTCGGA-3′. The detailed methods of transfection and infection were previously described [21 (link)].
+ Open protocol
+ Expand
4

Culturing Human Gallbladder Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human GBC cell lines NOZ, EH-GB1, GBC-SD, SGC-996 and OCUG were obtained from the Shanghai Cell Institute National Cell Bank. NOZ and SGC-996 were cultured in Williams' medium E and RPMI-1640 medium (HyClone, Logan, UT, USA), respectively. The EH-GB1, GBC-SD and OCUG cells were cultured in DMEM (Gibco, Grand Island, NY, USA). Cells were supplemented with 15% fetal bovine serum (FBS; Gibco) at 37°C in a 5% CO2 incubator.
+ Open protocol
+ Expand
5

Sourcing and Culturing Gallbladder and Ovarian Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human GBC cell lines were obtained as follows: GBC-SD and SGC-996, from the Shanghai Institutes for Biological Sciences (Shanghai, China), and OCUG-1 and NOZ were from the Japanese Collection of Research Bioresources JCRB cell Bank (Osaka, Japan). Human ovarian clear cell adenocarcinoma cell lines OVTOKO were also obtained from the JCRB Cell Bank. GBC-SD and OVTOKO cells were cultured in RPMI 1640 medium (Gibco, NY, USA), SGC-996 and OCUG-1 cells were cultured in Dulbecco’s Modified Eagle’s Medium (Gibco), and NOZ cells were cultured in William’s E medium (Gibco), with all media supplemented with 10% fetal bovine serum (Gibco), 10 units/ml penicillin, and 10 mg/ml streptomycin (1% P/S, Thermo Scientific HyClone, UT, USA). All cell lines were incubated at 37 °C in a humidified atmosphere containing 5% CO2 and subcultured during the logarithmic phase. GBC cell lines and OVTOKO cells were authenticated by short tandem repeat profiling, as described previously. The short tandem repeat profiles are presented in Supplementary Figure S2.
+ Open protocol
+ Expand
6

Cell Line Cultivation Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human GBC cell lines (NOZ, SGC-996, GBC-SD, and OCUG) and 293T cells were purchased from the Cell Bank of the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). All cells were cultured in medium (Williams’ medium for NOZ, Roswell Park Memorial Institute 1640 medium for SGC-996, Dulbecco modified Eagle medium for GBC-SD, OCUG, and 293T) containing 10% fetal bovine serum (Gibco, Sydney, Australia). Cells were incubated at 37°C in a 5% CO2 humidified incubator.
+ Open protocol
+ Expand
7

Galllbladder Cancer Cell Line Cultivation

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human gallbladder cancer cell lines GBC-SD, NOZ, SGC-996, OCUG, EHGB-1 and EHGB-2 were purchased from Shanghai Institute of Cell Biology, Chinese Academy of Sciences (CAS, Shanghai, China). The GBC-SD cells were grown in high-glucose DMEM (Gibco, Grand Island, NY, USA) supplemented with 10 % fetal bovine serum (Gibco) and 1 % penicillin-streptomycin(Hyclone, Logan, UT, USA). The NOZ cells were grown in William’s medium (Gibco) supplemented with 10 % fetal bovine serum (Gibco) and 1 % penicillin-streptomycin (Hyclone). The SGC cells were grown in 1640 medium (Gibco) supplemented with 10 % fetal bovine serum (Gibco) and 1 % penicillin-streptomycin (Hyclone), The OCUG, EHGB-1 and EHGB-2 cells were grown in high-glucose DMEM (Gibco) supplemented with 15 % fetal bovine serum (Gibco) and 1 % penicillin-streptomycin (Hyclone). All cells lines were maintained at 37 °C in a humidified atmosphere with 5 % CO2. The A66 used in the in vitro and in vivo experiments was purchased from Selleck Chemicals (Houston, USA). Before conducting the CO-IP experiments, the GBC-SD and NOZ cells were starved for 12 h and 1 ng/mL EGF (Sangon Biotech, Shanghai, China) was added to the cell culture medium. The cells were maintained for 12 h to eliminate other confounding growth factor signals.
+ Open protocol
+ Expand
8

Culture of Human Cell Lines GBC-SD and SGC-996

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human cell lines GBC-SD and SGC-996 were purchased from the Shanghai Cell Institute Country Cell Bank. GBC-SD cells were cultured in high-glucose DMEM (Gibco, USA) at 37°C in a 5% CO2 incubator, while SGC-996 cells were cultured in Roswell Park Memorial Institute (RPMI) 1640 medium. Both types of culture medium were supplemented with 10% fetal bovine serum (Gibco, USA), penicillin (100 U/mL) and streptomycin (100 U/mL) (Utah, HyClone, USA).
+ Open protocol
+ Expand
9

Cell Culture of GBC and 293T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human embryonic kidney 293T cells and human GBC cell line GBC-SD were purchased from the Chinese Academy of Life Sciences (Shanghai, China). Another GBC cell line NOZ was kindly gifted by Xinhua hospital (Shanghai, China).
GBC-SD and 293T cells were maintained in RPMI-1640 medium (GibcoBRL, Gaitherburg, MD, USA). NOZ cells were maintained in Willian’s E medium. All the cells were maintained in the medium supplemented with 1% antibiotics and 10% fetal bovine serum (GIBCO) at 37° C with 5% CO2.
+ Open protocol
+ Expand
10

Cultivation of Human Gallbladder Cancer Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human gallbladder cancer cell lines GBC-SD and NOZ were purchased from the Shanghai Cell Institute Country Cell Bank. GBC-SD cells were cultured in high-glucose Dulbecco’s modified eagle’s medium (DMEM) (Gibco, California, USA), and NOZ cells were cultured in William’s medium (Gibco) supplemented with 10% fetal bovine serum (Gibco), 100 μg/mL streptomycin, and 100 U/mL penicillin (Hyclone, Logan, UT) at 37°C in an atmosphere containing 5.0% CO2. Cells were routinely grown in 100-mm plastic tissue culture dishes (Corning, New York, USA) and harvested using a trypsin-EDTA solution when they reached the logarithmic growth phase. Cells were maintained in these culture conditions for all experiments.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!