Chromaspro v1
ChromasPro v1.34 is a software application designed for the analysis and management of DNA sequencing data. It provides a comprehensive set of tools for viewing, editing, and interpreting chromatogram files generated by automated DNA sequencers.
Lab products found in correlation
19 protocols using chromaspro v1
Phylogenetic Analysis of Gene Fragments
Identification of SNPs in Pig NR1H3 Gene
Six pairs of primers used for SNP identification in pig NR1H3
Name | Sequences (5′ to 3′) | Amplicon region | Amplicon size (bp) | annealing temperature |
---|---|---|---|---|
NR1H3-1 | F: TCCCACTCTGAGGTTCTTTTT | Exon 1 | 235 | 58 °C |
R: CTTACGGACCTGACACTGGA | ||||
NR1H3-2 | F:GCCAGGAAAGCCTTAGCACA | Exon 2 | 361 | 60 °C |
R: AGGAGGCAAGCAACAGCAAG | ||||
NR1H3-3 | F:CTGAGACCCCCCCTGTGC | Exon 3 | 259 | 59 °C |
R: GCCCCTACCTCCTCCAAATC | ||||
NR1H3-4 | F: GAACATTAAGCCTCTTCCAT | Exon 4 | 347 | 54 °C |
R: TTCCCTCTTTCCTATCAGC | ||||
NR1H3-5 | F: ATCTCTTCCTTGTCTTTACCC | Exon 5, exon 6 and exon 7 | 889 | 56 °C |
R: CAATCCCTTTGTGATCTCAG | ||||
NR1H3-6 | F: AGCAGTTTCCTCAGTTGAGC | Exon 8, exon 9 and exon 10 | 1029 | 56 °C |
R: AGGGTCAGTACCGTCTTCAC |
Structure of the pig NR1H3 gene and the positions of primers used for SNP identification. The thick black lines represent introns; the grey blocks represent exons of the NR1H3 gene; the thin black lines represent positions of amplicons. Pig total DNA was used as PCR templates for the NR1H3-1, NR1H3-2, NR1H3-3, NR1H3-4, NR1H3-5 and NR1H3-6 primers
Bacterial Identification by 16S rRNA Sequencing
Genetic Identification of Petaurus Species
Phylogenetic Analysis of Gene Fragments
Phylogenetic Analysis of Gene Fragments
DNA Sequence Characterization of Prosopis Species
Fungal Ribosomal RNA Sequencing Protocol
Genetic Sequencing of ERCC Genes
PCR primers were designed using Primer3 software to amplify each of the 12 exons of ERCC8 gene and the 21 exons of ERCC6 gene as well as their flanking intronic sequences (Additional file
Sequencing of ANTXR2 Genomic Variant
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!