Quikchange kit

Human hepatoma cells (HepG2 and HepaRG) and human neutrophil‐like leukemia cells (HL‐60) were maintained in DMEM supplemented with 10% fetal bovine serum (FBS, Hyclone). Primary hepatocytes were isolated and cultured as previously described (Fan et al, 2019 ). Human CXCL14 promoter‐luciferase construct was generated by amplifying genomic DNA spanning the proximal promoter and the first exon of CXCL14 gene (−2,000/+94) and ligating into a pGL3‐basic vector (Promega). The mouse Smarca4 promoter‐luciferase constructs were cloned using a similar strategy. Mutant constructs were generated by a QuikChange kit (Thermo Fisher, Waltham, cat# 200514) and verified by direct sequencing. Small interfering RNAs were purchased from Dharmacon. Transient transfections were performed with Lipofectamine 2000. Luciferase activities were assayed 24–48 h after transfection using a luciferase reporter assay system (Promega, cat# E1500).

Primary cardiac fibroblasts were isolated and maintained in DMEM supplemented with 10% FBS as previously described (Gao et al., 2020 (link); Liu et al., 2020 (link); He et al., 2021 (link); Zhao et al., 2021 (link)). Mouse embryonic fibroblasts (MEFs) were isolated and maintained in DMEM supplemented with 10% FBS as previously described (Angrisani et al., 2021 (link)). Clca2 promoter-luciferase construct was made by amplifying genomic DNA spanning the proximal promoter and the first exon of Clca2 gene (−1100/ + 91) and ligating into a pGL3-basic vector (Promega). Truncation mutants were made using a QuikChange kit (Thermo Fisher Scientific, Waltham, MA, United States) and verified by direct sequencing. Small interfering RNAs were purchased from Dharmacon. Transient transfection was performed with Lipofectamine 2000. Cells were harvested 48 h after transfection and reporter activity was measured using a luciferase reporter assay system (Promega) as previously described (Kong et al., 2021a (link), c (link); Liu et al., 2021c (link); Zhang et al., 2021 (link)). MS-275 and MC-1568 were purchased from Selleck. Mouse recombinant TGF-β was purchased from R&D.

Human immortalized umbilical vein endothelial cells (HUVEC/EAhy926, ATCC), human monocytic/macrophage cells (THP-1, ATCC), and human embryonic kidney cells (HEK293, Invitrogen) were maintained in DMEM (Invitrogen) supplemented with 10% fetal bovine serum (FBS, Hyclone) as previously described (Chen et al., 2020 (link); Yang et al., 2021 (link)). Human primary aortic endothelial cells (HAEC, Cambrex/Lonza) were maintained in EGM-2 media with supplements supplied by the vendor; experiments were performed in primary cells between 3rd and 6th passages as previously described (Li et al., 2020 (link)). FLAG-tagged CREB1 (Mayr et al., 2005 (link)) and GFP-tagged BAF47 (Kadoch and Crabtree, 2013 (link)) have been described previously. Neo-1 promoter-luciferase construct was made by amplifying genomic DNA spanning the proximal promoter and the first exon of Neo-1 gene (−1274/+101) and ligating into a pGL3-basic vector (Promega). Truncation mutants were made using a QuikChange kit (Thermo Fisher Scientific, Waltham, MA, United States) and verified by direct sequencing. Small interfering RNAs were purchased from Dharmacon. Transient transfection was performed with Lipofectamine 2000. Cells were harvested 48 h after transfection and reporter activity was measured using a luciferase reporter assay system (Promega) as previously described (Liu et al., 2021 (link)).

Primary murine hepatocytes were isolated as previously described (Kong et al., 2021b (link)). Mouse recombinant HGF was purchased from R&D. The cells were treated with HGF (20 ng/ml) for 12–48 h as indicated. BRG1 expression construct has been previously described (Li et al., 2020 (link)). MYCN promoter-luciferase construct was generated by amplifying genomic DNA spanning the proximal promoter and the first exon of MYCN gene (−225/ + 18) and ligating into a pGL3-basic vector (Promega). Mutagenesis was performed a QuikChange kit (Thermo Fisher Scientific, Waltham, MA, United States). All DNA constructs were verified by direct sequencing. Small interfering RNAs were purchased from GenePharma: siFoxp2, CGAAUUUUAUAAAAACGCA; siFoxp1, GCAGGCGGTACTCAGACAAAT; siTwist2, AC AGUAAGAAGUCGAGCGAAGAUGG; siE2f5, GUUCGUGU CGCUGCUGCAGTT; siTfdp1, GGAGACTTGAAAGAATAAA. Cells were harvested 24–48 h after the transfection. Transient transfections were performed with Lipofectamine 2000. Luciferase activities were assayed using a luciferase reporter assay system (Promega) as previously described (Zhang et al., 2021 (link)).