Total RNA was isolated using the High Purity Total RNA Rapid Extraction Kit (BioTeke, Beijing, China) according to the manufacturer's instructions, and the absorbances of the extracted RNAs at 260 nm and 280 nm were determined spectrophotometrically (Molecular Devices, Ramsey MN USA). RNA samples with purity ratios (A260/A280) between 1.8 and 2.0 were used for synthesizing single-strand cDNA by means of All-in-One cDNA Synthesis SuperMix (Bimake) for quantitative real-time polymerase chain reaction (qPCR). Gene-specific primers (Table 1 ) were designed by Invitrogen (Carlsbad, CA, USA). qPCR was performed to detect the relative mRNA expression levels using 2 ×SYBR Green qPCR Master Mix (Bimake) as described in the protocol. To determine the specificity of the amplification, melting curve analysis was performed for all final PCR products. Relative changes in gene expression were calculated and expressed as fold changes using the relative quantification (ΔΔCt) method. The relative abundance of each transcript was normalized to that of β-actin. Each sample was run in triplicate.
High purity total rna rapid extraction kit
Manufactured by BioTeke
Sourced in China
The High purity total RNA rapid extraction kit provides a fast and efficient method for isolating high-quality total RNA from a variety of biological samples. The kit utilizes a specialized reagent system to ensure thorough lysis and denaturation of samples, allowing for the effective extraction and purification of total RNA.
Automatically generated - may contain errors
Lab products found in correlation
Taq hs perfect mix, by Takara Bio (2 mentions)
Sybr green qpcr master mix, by Selleck Chemicals (1 mentions)
All in one cdna synthesis supermix, by Selleck Chemicals (1 mentions)
M mlv reverse transcriptase, by Takara Bio (1 mentions)
Rnase inhibitor, by Takara Bio (1 mentions)
Sybr green, by BioTeke (1 mentions)
Faststart universal sybr green master mix, by Roche (1 mentions)
Super rt kit, by BioTeke (1 mentions)
Cfx96 instrument, by Bio-Rad (1 mentions)
Iscript cdna synthesis, by Bio-Rad (1 mentions)
Realstar green fast mixture, by GenStar (1 mentions)
Tissue genomic dna extraction kit, by BioTeke (1 mentions)
Cfx96, by Bio-Rad (1 mentions)
Sybr green mix, by Roche (1 mentions)
Revertra ace kit, by Toyobo (1 mentions)
Sybr green, by Takara Bio (1 mentions)
Exicycler 96 system, by Bioneer (1 mentions)
8 protocols using high purity total rna rapid extraction kit
1
Quantitative Gene Expression Analysis
2
Quantification of miR-188-5p Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time PCR was performed to measure relative expression levels of miR-188-5p. High purity total RNA rapid extraction kit (BioTeke, Beijing, China) was adopted to extract total RNA of samples. Extracted RNAs were reversely transcribed into cDNAs using M-MLV reverse transcriptase (Takara, Beijing, China) with RNase inhibitor (Takara) by Stem loop method. Followed real-time PCR reaction was performed with the help of Taq HS Perfect Mix (Takara) and SYBR Green (BioTeke). The U19 and β-actin were adopted as an internal reference. The primers were synthesized by GenScript (Nanjing, China) and sequences of them were listed as follow: miR-188-5p (forward): 5′-CGATATTCATCCCTTGCATGGT-3′; (reverse): 5′-TGCAGGGTCCGAGGTATT-3′; U19 (forward): 5′-TGGAGTTGATCCTAGTCTGG-3′; (reverse): 5′-GTGCAGGGTCCGAGGTAT-3′. MALAT1 (forward): 5′-ATACCTAACCAGGCATAACA-3′; (reverse): 5′-AGTAGACCAACTAAGCGAAT-3′; β-actin (forward): 5′-GGCACCCAGCACAATGAA-3′; (reverse): 5′-TAGAAGCATTTGCGGTGG-3′. Finally, the results were analyzed using 2−ΔΔCT methods.
3
Quantitative RT-PCR Analysis of Rat Myocardial Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from rat myocardial tissues by using a high-purity total RNA rapid extraction kit (BioTeke Corporation, Beijing). According to the manufacturer's (BioTeke Corporation, Beijing) instructions, total RNA was reverse transcribed into cDNA for qPCR using the BioTeke Super RT Kit. Roche FastStart Universal SYBR Green Master Mix (Rox) was used for qRT-PCR through the first-step system. The mRNA level of each gene was normalized to the mRNA level of β-actin. The PCR conditions were as follows: initial activation at 50°C for 2 minutes and activation at 95°C for 10 minutes, followed by denaturation at 95°C for 15 s, and annealing and extension at 60°C for 1 minute for 40 cycles. The primers used for real-time PCR are listed in Table 1 .
4
Total RNA Isolation and RT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using the High-purity Total RNA Rapid Extraction kit (RP1201; BioTeke, Beijing, China). Real-time RT-PCR was performed using iScript cDNA Synthesis and SYBR-Green Gene Expression Assay kits (Bio-Rad, Philadelphia, PA, USA). Real-time RT-PCR and data collection were performed on a CFX96 instrument (Bio-Rad).
5
Quantitative Analysis of StPIN Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from treated and control samples using high purity total RNA rapid extraction kit (BioTeKe, Beijing, China) and then Fast Super RT Kit cDNA with gDNase was used to perform reverse transcription according to the manufacturer’s instructions. Design of StPIN gene-specific primers for quantitative real time PCR (qRT-PCR) analysis were conducted using Primer Primer 5 software and synthesized in Sangon (Shanghai, China) (Table S4 ). Quantitative RT-PCR (qRT-PCR) was carried out on the Bio-Rad CFX96 Real Time PCR System using 2 × RealStar Green Fast Mixture (GenStar, Beijing, China) according to manufacturer’s protocol and Elongation factor 1-a (ef1-a) as the internal reference gene to normalize the expression of StPIN genes [51 (link)]. PCR amplification was performed in a total volume of 10 μL reaction mixture containing 0.4 μL cDNA as template, 5 μL RealStar Green Fast Mixture (2×), 0.4 μL of each forward and reverse primer (10 μM) and RNase-free water up to 10 μL. The thermal cycling conditions were set as follows: initial activation 95 °C for 2 min, then 40 cycles of 95 °C for 15s, 60 °C for 15s and 72 °C for 30s. A melting curve was generated from 65 °C to 95 °C. 2−∆∆Ct method [52 (link)] was employed to visualize the expression data about each treatment of each gene. All the expression analyses were based on three biological and two technical replicates.
6
Quantification of HIF-1α and mtDNA Content
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For quantification of HIF-1α, total RNA was extracted using a high-purity total RNA rapid extraction kit (BioTeke, Beijing, China) and reverse-transcribed into cDNA using
the M-MLV reverse transcriptase. RT-qPCR was then performed on the ExicyclerTM 96 fluorescence quantifier using SYBR Green Master Mix. The relative mRNA expression of HIF-1αwas calculated by the 2-ΔΔCt method and normalized to β-actin. For mitochondrial DNA (mtDNA) content determination, DNA extraction was performed using a tissue genomic DNA
extraction kit (BioTeke). The copy number of mtDNA was evaluated by RT-qPCR, as described in a previous study [23 (link)]. The primers used, synthesized by
GenScript (Nanjing, China), were listed inTable 1 Sequence of primers used in RT-qPCR
the M-MLV reverse transcriptase. RT-qPCR was then performed on the ExicyclerTM 96 fluorescence quantifier using SYBR Green Master Mix. The relative mRNA expression of HIF-1αwas calculated by the 2-ΔΔCt method and normalized to β-actin. For mitochondrial DNA (mtDNA) content determination, DNA extraction was performed using a tissue genomic DNA
extraction kit (BioTeke). The copy number of mtDNA was evaluated by RT-qPCR, as described in a previous study [23 (link)]. The primers used, synthesized by
GenScript (Nanjing, China), were listed in
| Gene | Primers | Sequence (5’-3’) |
|---|---|---|
| mtDNA | Forward | TGAGCCATCCCTTCACTAGG |
| Reverse | TGAGCCGCAAATTTCAGAG | |
| nuclear DNA (β-actin) | Forward | CTGCTCTTTCCCAGATGAGG |
| Reverse | CCACAGCACTGTAGGGGTTT | |
| HIF-1α | Forward | CTACTATGTCGCTTTCTTGG |
| Reverse | GTTTCTGCTGCCTTGTATGG | |
| β-actin | Forward | GGAGATTACTGCCCTGGCTCCTAGC |
| Reverse | GGCCGGACTCATCGTACTCCTGCTT | |
7
Transcriptional Profiling of Potato Cultivar
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The plants of potato cultivar ‘Desire’ was cultivated in greenhouse of Northwest A&F University from March to June (23 ± 2 °C,16 h light/8 h dark). The different tissues and organs were collected at different time after sprouting. Stem, leaf, and flower were sampled at flowering, whereas stolons and young tubers were collected ten days after flowering. In addition, mature tubers were taken 90 days after sprouting. All samples were immediately frozen in liquid nitrogen and stored at -80 °C until used. Total RNA was extracted using a high purity total RNA rapid extraction kit (BioTeke, RP1202, China) and first-strand cDNA was synthesized using a ReverTra Ace Kit (TOYOBO, FSK-100, Japan) following the manufacturer’s instructions.
Primer 5.0 was used to design gene-specific primers of MADS-box in potato (Additional file1 : Table S1). Real-time quantitative RT-PCR was performed by using the SYBR green mix (KAPA, KK4601, USA) in a Real-time PCR machine (BioRad, CFX96, USA). The internal reference gene was ef1α and three biological replicates were used to estimate the expression level by the method of two stand curves as described previously [38 (link)].
Primer 5.0 was used to design gene-specific primers of MADS-box in potato (Additional file
8
miRNA-34a and Klf4 Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA in the perihemorrhagic penumbra was extracted using the high purity total RNA rapid extraction kit (BioTeke, Beijng, China) and quantified by an ultraviolet spectrophotometer. The isolated RNA was transcribed into the relevant cDNA by miR-34a-5p stem-loop RT primer or respective primer, the expression levels of miR-34a-5p and Klf4 were detected by RT-PCR utilizing Taq HS Perfect Mix (Takara, Dalian, China) and SYBR Green (Takara) in an Exicycler 96 System (Bioneer, Daejeon, Korea). 5S and β-actin were used as the internal reference. The data was analyzed by 2-ΔΔCT method.
The primers for RT-PCR were as follows:
MiR-34a-5p stem-loop RT primer: 5’-GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACACAACC-3’; Forward: 5’-GGACTTGGCAGTGTCTTAGCTG-3’; Reverse: 5’-GTGCAGGGTCCGAGGTATTC-3’
Klf4 Forward: 5’-GGAGCCCAAGCCAAAGAGG-3’; Reverse: 5’-CGTCCCAGTCACAGTGGTAAGGT-3’
The primers for RT-PCR were as follows:
MiR-34a-5p stem-loop RT primer: 5’-GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACACAACC-3’; Forward: 5’-GGACTTGGCAGTGTCTTAGCTG-3’; Reverse: 5’-GTGCAGGGTCCGAGGTATTC-3’
Klf4 Forward: 5’-GGAGCCCAAGCCAAAGAGG-3’; Reverse: 5’-CGTCCCAGTCACAGTGGTAAGGT-3’
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!