The sequence of hsa_circ_0008945 (circBase ID: hsa_circ_0008945; 384 bp) was obtained from human circRNA database circBank (http://www.circbank.cn ). The full-length sequence of hsa_circ_0008945 was custom synthesized and inserted between BamHI and XhoI site of pcDNA3.0 vector((Invitrogen). The pcDNA3.0 vector was employed as negative control (OE-NC). si-NC (negative control; sequence: TTCTCCGAACGTGTCACGTTT), si-circRNA (si-hsa_circ_0008945 sequence: ATGCTGGTGGCAAGCTGCACATT) were synthesized by GenePharma (Shanghai, China).
Si circrna
Manufactured by GenePharma
Sourced in China
Si-circRNA is a laboratory equipment product designed for the analysis and study of circular RNA (circRNA) molecules. It provides a platform for the detection, quantification, and characterization of circRNA in biological samples. The core function of Si-circRNA is to enable researchers to investigate the roles and functions of circRNA in various cellular processes and disease states.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 3000 reagent, by Thermo Fisher Scientific (2 mentions)
Pcdna3.0 vector, by Thermo Fisher Scientific (1 mentions)
Si nc, by GenePharma (1 mentions)
Tfk 1, by American Type Culture Collection (1 mentions)
Huh28, by American Type Culture Collection (1 mentions)
Lipofectamine rnaimax, by Thermo Fisher Scientific (1 mentions)
Anti mir 217, by GenePharma (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (1 mentions)
Aml 193, by American Type Culture Collection (1 mentions)
Molm 13, by American Type Culture Collection (1 mentions)
5 protocols using si circrna
1
Overexpression and Silencing of circRNA
2
Silencing hsa_circ_0000673 in CCA cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human CCA cell lines RBE, TFK-1, KMBC, and HuH28 were purchased from the American Type Culture Collection (Manassas, VA, USA). Cells were cultured with RPMI-1640 medium (Hyclone, Logan, UT, USA) supplemented with 10% FBS and penicillin/streptomycin at 37° C with 5% CO2.
SiRNA against hsa_circ_0000673 (si-circRNA: 5′-TATTAGACGTTCTTGGTGAAAATCTTTACA-3′) was designed and synthesized by GenePharma (Shanghai, China). Following the manufacturer’s instructions, 50 nM of siRNA was transfected into RBE and KMBC cells using Lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA, USA).
SiRNA against hsa_circ_0000673 (si-circRNA: 5′-TATTAGACGTTCTTGGTGAAAATCTTTACA-3′) was designed and synthesized by GenePharma (Shanghai, China). Following the manufacturer’s instructions, 50 nM of siRNA was transfected into RBE and KMBC cells using Lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA, USA).
3
Targeting Circular RNA in MSC Adipogenesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A predesigned siRNA targeting human circ-CRLF1 (si-circRNA) and negative control (scramble siRNA, si-scramble) were purchased from GenePharma Co., Ltd. (Shanghai, China). The sequences used are listed in Additional file 7 : Table S6. MSCs were transfected with siRNA at a final concentration of 20 nM on day 0, 2 and 4 during adipogenesis, using Lipofectamine RNAiMAX (Invitrogen, Cat.No. 13778075), according to the manufacturer’s protocol. Cells were harvested on day 7 post-transfection.
4
Silencing CircRNA and miR-217 in Ishikawa Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
si-NC (negative control) sequence: UUCUCCGAACGUGUCACGUTT, si-circRNA (si-hsa_circ_0023404 #1–3; #3 sequence: GGUUCCUGCUAAUCUAUAATT, miR-217 or anti-miR-217 were synthesized by GenePharma (Shanghai, China). They were transfected in Ishikawa cells using Lipofectamine 3000 Reagent (Life Technologies, USA) and then culture in at 37 °C and 5% CO2 for 48–72 h.
5
Knockdown of hsa_circ_0079480 in AML cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
AML cell lines (MOLM-13 and AML-193) were bought from American Type Culture Collection (ATCC, Manassas, VA, USA) and grown using RPMI-1640 medium (Gibco, Waltham, MA, USA), which contains 10% fetal bovine serum (FBS; Gibco), in an incubator at 5% CO2 at 37° C.
siRNA that target hsa_circ_0079480 (si-circRNA), miR-654-3p mimics, miR-654-3p inhibitors, and negative controls [17 (link)] were acquired through GenePharma (Shanghai, China). The transfection was conducted through the use of Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) as per established guidelines.
siRNA that target hsa_circ_0079480 (si-circRNA), miR-654-3p mimics, miR-654-3p inhibitors, and negative controls [17 (link)] were acquired through GenePharma (Shanghai, China). The transfection was conducted through the use of Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) as per established guidelines.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!