The largest database of trusted experimental protocols

Sirna targeting

Manufactured by Horizon Discovery
Sourced in United States

SiRNA targeting is a gene silencing technique that utilizes small interfering RNA (siRNA) molecules to suppress the expression of specific genes. The core function of this technology is to induce the degradation of target mRNA, thereby reducing the production of the corresponding protein. This approach allows for the investigation of gene function and can be used for therapeutic applications.

Automatically generated - may contain errors

10 protocols using sirna targeting

1

MCT Silencing by siRNA Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols
Silencing of MCT expression was done with siRNA targeting MCT1, MCT2, and MCT4 (Dharmacon, Lafayette) using HiPerfect transfection reagents (Qiagen) according to the manufacturer's instructions.
+ Open protocol
+ Expand
2

RNA Interference Targeting Gli Transcription Factors

Check if the same lab product or an alternative is used in the 5 most similar protocols
HCT116 or HT29 cells were seeded in six-well plates. After an overnight incubation, the cells were transfected with 20 nM of either scrambled siRNA or siRNA targeting Gli1 or Gli2 (Dharmacon, Lafayette, CO, USA) using INTERFERin (Polyplus transfection) according to the manufacturer’s instruction. The cells were collected 48 hours after transfection and subjected to quantitative real-time PCR or Western blot to examine gene expression.
+ Open protocol
+ Expand
3

Knockdown of LSD1 protein in Tet-21/N cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
100 nM siRNA targeting LSD1 (GE Dharmacon) or scramble were transfected in Tet-21/N cells using a MicroPorator Digital Bio Technology, according to the recently described protocol [6 (link)]. Briefly, 2×106 cells were collected by trypsin/EDTA digestion, washed once with calcium and magnesium-free PBS and resuspended in 100 μl of resuspension buffer, mixed with siRNA or scramble and electroporatated according to the manufacturer's protocol. Transfected cells were seeded in a 100 mm dish in antibiotic-free DMEM supplemented with 10% FBS. The efficiency of siRNA to knockdown LSD1 protein expression was assayed 48h after transfection by western blot.
+ Open protocol
+ Expand
4

Src Pathway Modulation in Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Dasatinib and Erlotinib were purchased from LC Laboratories (Woburn, MA, USA), 17-AAG and LY294002 were purchased from EMD Chemicals (Gibbstown, NJ, USA), respectively. Unless otherwise indicated, chemicals were purchased from Sigma-Aldrich (St. Louis, MO, USA). The constitutively active Src mutant (Src (Y527F)) expression vector was kindly provided by Dr. Faye M. Johnson (MD Anderson Cancer Center, Houston, TX, USA). The HSP90 expression vector was kindly provided by Dr. William C. Sessa (Yale University School of Medicine, CT, USA). siRNA targeting Src was purchased from Dharmacon.
+ Open protocol
+ Expand
5

Sensitizing U251 Cells to TMZ

Check if the same lab product or an alternative is used in the 5 most similar protocols
U251-derived TMZ-resistant cells were plated at 105/mL in 6-well plates in DMEM media without antibiotics. Twenty-four hours later, the cells were transfected with an optimized amount (5 nmol/L) of siRNA targeting human RAD51 (Dharmacon, Lafayette, CO, USA) or non-targeting siRNAs using DharmaFECT reagent (Dharmacon) according to the manufacturer’s protocol as described previously [13 (link)].
+ Open protocol
+ Expand
6

Targeting Transcription Factors in Melanoma

Check if the same lab product or an alternative is used in the 5 most similar protocols
A375 crSOX10 knockout cells were transfected with either siGenome non-targeting control (Dharmacon, Lafayette, CO, #CTM-602672/APLAB-000061), siRNA targeting JUND (Dharmacon, Lafayette, CO, #D-003900-09, #D-003900-08) or siRNA targeting FOSL2 (Dharmacon, Lafayette, CO, #D-004110-01) at a final concentration of 25 nM using Lipofectamine RNAiMAX (Invitrogen, San Diego, CA, #56532). Sequences are as follows: JUND#9, GAAACACCCUUCUACGGCG; JUND#8, CGCUCAAGGACGAGCCACA; FOSL2#1, GGCCCAGUGUGCAAGAUUA; Non-targeting siGenome control, UAGCGACUAAACACAUCAAUU. MeWo and A375 parental and crSOX10 knockout cells were transfected with either on-target control siRNA (Dharmacon, Lafayette, CO, #D-001810-01) or siRNA targeting cIAP1 (Dharmacon, Lafayette, CO, #J-004390-12), and MeWo MTC, A375 CRT34 cells, and A375 CRT35 cells were transfected with either siGenome non-targeting control (Dharmacon, Lafayette, CO, #CTM-602672/APLAB-000061), siRNA targeting NFκB p50 (Dharmacon, Lafayette, CO, #D-003520-01), or siRNA targeting NFκB p65 (Cell Signaling, Danvers, MA, #6261) at a final concentration of 25 nM using Lipofectamine RNAiMAX (Invitrogen, San Diego, CA). Sequences are as follows: cIAP1, UCGCAAUGAUGAUGUCAAA; NFκB p50, GCAGGUAUUUGACAUAUUA; NFκB p65, the sequence is not publicly available; On-target control, UGGUUUACAUGUCGACUAAUU; Non-targeting siGenome control, UAGCGACUAAACACAUCAAUU.
+ Open protocol
+ Expand
7

Histone Methyltransferase Knockdown Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
The knockdown of G9a or GLP individually or simultaneously using siRNA was performed in 6-well or 12-well plates as previously described [28 (link)]. Briefly, siRNA targeting G9a (Cat #: L-053728-01-0005) or GLP (Cat #: L-059041-01-0005) was purchased from Dharmacon (Lafayette, CO, USA). Media changes were performed every 24 h, and nontargeting siRNA acted as a negative control for the knockdown experiments. Transfection with 50 nM siRNA was repeated after the initial 24 h incubation. Cells were harvested 72 h following the initial transfection. Extracts for protein analyses were prepared by collecting cells in immunoprecipitation (IP) buffer (10 mM Tris (pH 7.4), 150 mM NaCl, 1 mM EGTA, 1 mM EDTA, 1% Triton X-100, 0.5% IGEPAL CA-630, protease inhibitors (1 mM phenylmethylsulfonyl fluoride, 1 µM pepstatin, 50 trypsin inhibitory milliunits of aprotinin, 10 µM leupeptin, 1 mM 1,10-phenanthroline), and phosphatase inhibitor (0.2 mM sodium vanadate)). To extract RNA for gene expression analyses, cells were harvested in buffer provided in the RNeasy mini kit (Qiagen, Hilden, Germany). As a positive control to assess siRNA transfection efficiency, a knockdown of Cyclophilin B (Dharmacon, Lafayette, CO, USA; Cat #: D-001820-02-05) was also performed [28 (link)].
+ Open protocol
+ Expand
8

Bcl-XL and NIK Knockdown in CLL Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
CLL cells were transfected using the Amaxa nucleofection technology (Amaxa) as previously described10 (link) with 3 µg siRNA targeting Bcl-XL and non-targeting siRNA (Ambion, Thermo Fisher Scientific) or 3 µg siRNA targeting NIK and non-targeting siRNA (Dharmacon). After nucleofection, cells were cultured on 3T40L for 24 h before drugs sensitivity assay was performed or protein lysates were obtained.
+ Open protocol
+ Expand
9

Silencing TBK1 in Prostate Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
siRNA targeting TBK1 was purchased from Dharmacon. Transient transfection of prostate cancer cells was performed using lipofectamine 2,000 (Invitrogen). Briefly, 400,000 cells were seeded into 6-well plates. After 24 hours, cells were transfected with 5-μmol/L siRNA for 4 hours. Before transfection, the siRNA was mixed with lipofectamine 2,000 for 20 minutes, according to the manufacturer's instructions. The transfection medium was replaced by RPMI supplemented with 10% FBS. Cells were collected and analyzed 48 hours later.
+ Open protocol
+ Expand
10

Signaling Pathways in Huh7 Hepatoma Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human hepatoma-7 (Huh7) cells were cultured in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum (FBS) supplemented with penicillin and streptomycin. Antibodies to GAPDH, AKT, phosphor-AKT, ERK1/2, phosphor-ERK1/2, STAT3, and phosphor-STAT3 were purchased from Cell Signaling Technology (Beverly, MA). Antibodies to NEDD4 and PTEN were purchased from Abcam (Cambridge, USA). Alexa Fluor 488 goat anti-mouse antibody, Alexa Fluor 555 rabbit anti-mouse antibody, Alexa Fluor 555 Phalloidin, HRP-conjugated secondary antibodies, DMEM, FBS, penicillin, streptomycin and lipofectamine 2000 were purchased from Invitrogen (Shanghai, China). siRNA targeting NEDD4 was purchased from Dharmacon (GE Healthcare Life Sciences, Piscataway, NJ) and Matrigel Matrix was obtained from BD Biosciences (San Jose, CA). Cell-light EdU DNA cell proliferation kit was purchased from RiboBio (Guangzhou, China). Transwell chamber dishes and cell culture plates were purchased from Corning Inc (Corning, NY).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!