Sixteen frogs were captured with a hand net, eight frogs from the polluted site (five males, three females), and eight frogs from the reference sites (four males, four females). The animals were handled with nitrile gloves, previously disinfected with ethanol (70%). Immediately before skin cultivable microbiota collection, each frog was rinsed abundantly (dorsal and ventral side) with sterile distilled water to ensure the collection of skin-associated microbes rather than water-associated transient microbes [46 (link)]. The skin cultivable microbiota was collected using sterile swabs that were scrubbed along the animal, following the protocol described by Brem et al. [47 ]. To standardize the procedure, each frog was swabbed five times along the length of the ventral and dorsal region, head, lateral region, the surface of thigh and legs. All the frogs were maintained closed in a bucket for a limited amount of time to prevent double sampling and then released into their habitat. Swabs were placed in a sterile 1.5 mL tube with 500 µL of Nutrient Broth medium (Merck Millipore, Germany), 10x diluted, and immediately placed on ice until lab arrival, where they were further processed according to Costa et al. [36 (link)] for bacteria isolation.
Nutrient broth medium
Manufactured by Merck Group
Sourced in Germany
Nutrient broth medium is a general-purpose culture medium used for the growth of a wide range of microorganisms. It provides essential nutrients and growth factors required for the cultivation of various bacterial and fungal species.
Automatically generated - may contain errors
Lab products found in correlation
Nutrient agar medium, by Merck Group (2 mentions)
Sodium chloride (nacl), by Merck Group (2 mentions)
Muller hinton agar medium, by Merck Group (1 mentions)
Mannitol salt agar medium, by Merck Group (1 mentions)
Nutrient agar, by Merck Group (1 mentions)
Streptomycin, by Merck Group (1 mentions)
Dimethyl sulfoxide (dmso), by Merck Group (1 mentions)
L 1 yeast extract, by Merck Group (1 mentions)
L 1 sucrose, by Merck Group (1 mentions)
Potato dextrose agar (pda), by Merck Group (1 mentions)
Yeast extract, by Merck Group (1 mentions)
Bacto agar, by Merck Group (1 mentions)
Carvacrol, by Merck Group (1 mentions)
El800 microplate reader, by Agilent Technologies (1 mentions)
Dulbecco s phosphate buffered saline pbs, by Merck Group (1 mentions)
96 well plate, by Sarstedt (1 mentions)
Agar, by Merck Group (1 mentions)
14 protocols using nutrient broth medium
1
Skin Microbiome of Frogs in Polluted Sites
2
Antimicrobial Evaluation of Nanoparticles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The antimicrobial activity of nanoparticles was evaluated by the agar well diffusion method. Briefly, the nutrient broth medium (Merck Millipore) was used to prepare a bacterial suspension with a standard concentration of 0.5 McFarland. 0.1mLof the inoculums of test organism was spread uniformly on Muller Hinton agar medium (Merck Millipore) and then wells were prepared using a sterile cork borer. Cups were filled with 10 mg of each antimicrobial sample. Plates were incubated at 37 °C for 24 h. The zone of inhibition of bacterial growth around the well was measured with a caliper (Muraleedaran and Mujeeb, 2015 ).
3
Biosorption of Al by V. alginolyticus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bacterial species used in this experiment were the gram-negative bacteria of V. alginolyticus.Titah et al. (2019) showed that this species can remove Al from wastewater via a biosorption mechanism. The inoculum of bacteria was prepared overnight (24 h) in a nutrient broth medium (Merck, Germany), harvested with 3000 rpm centrifuge for 15 min (Macario, 2012 ) and diluted with physiological solution (8.5% NaCl) before application until the initial optical density of 1 Å (approximate cell counts of 9 Log CFU/ml) (Purwanti et al., 2019b ). The bioaugmentation of bacteria was performed in the beginning of the phytoremediation test using v/v ratio of 2% (initial cell counts of 6.5 ± 0.7 Log CFU/g) and 5% (initial cell counts of 7.0 ± 0.3 Log CFU/g) (Purwanti et al., 2019c ).
4
Isolation and Storage of P. aeruginosa
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
One hundred isolates of P. aeruginosa were collected during the study period (from Dec 2017 to Jul 2018) from different clinical samples of the patients admitted to Milad and Pars Hospitals at Tehran, Iran. Standard strains of P. aeruginosa ATCC 27853, P. aeruginosa PAO1 and P. aeruginosa 8821M were used as controls. Bacteria were stored at −70 °C in the nutrient broth medium (Merck, Germany) containing 15% glycerol. Nutrient agar medium (Merck, Germany) was used for bacterial growth (8 ).
5
Isolation and Optimization of N-Fixing Bacteria
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The medium used for the isolation of N-fixing bacterium, preservation in the slants as well as optimization of N-ase activity, was selective N-free agar medium (composition in gram per liter: K2HPO4 1.0; FeS04 0.05; CaCl2 0.1; MgSO4·7H2O 0.2; Na2MoO4 0.001; glucose 10; agar 15) as described by Benson (1994 ). The nutrient broth medium (Merck) was used for reviving the bacterial growth from the N-free selective agar slants and preparation of inoculum. It was comprised of gram per liter: meat extract 3 and peptone from meat 5.
6
Bacterial Growth Optimization Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Each colony of bacterial strains (24 hours of age) was taken in 20mL of lysogeny broth (L.B) followed by incubation for 24 h with 101 revolutions to obtain a better growth of each strain.
Nutrient Broth medium (Merck-Germany) with composition, meat extract-peptone (12 g/L Agar-agar, 5 g/L Peptone from meat and 3 g/L meat extract) was used for the preparation of growth medium. The turbidity of the strains was optimized using a McFarland 0.5 BaSO 4 turbidity standard until the formation of 10 6 colonies per mL (Koneman et al. 1997) . The inoculums were used for culturing the nutrient agar plates.
Nutrient Broth medium (Merck-Germany) with composition, meat extract-peptone (12 g/L Agar-agar, 5 g/L Peptone from meat and 3 g/L meat extract) was used for the preparation of growth medium. The turbidity of the strains was optimized using a McFarland 0.5 BaSO 4 turbidity standard until the formation of 10 6 colonies per mL (Koneman et al. 1997) . The inoculums were used for culturing the nutrient agar plates.
7
Staphylococcus aureus Isolation and Preservation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In this descriptive cross-sectional study 40 samples were collected from the nasal mucosa of Sari Burn hospital staff by a simple sampling method, and cultured on the nutrient agar medium (Merck, Germany). In the next step, colonies suspected of Staphylococcus aureus were tested using gram staining, catalase, oxidase, and coagulase tests. Colonies suspected of Staphylococcus aureus were cultured in mannitol salt agar medium (Merck, Germany). After culturing the bacteria in the mannitol salt agar medium, after 24 hours of culturing the bacteria, a colony loop was inoculated into the nutrient broth medium (Merck, Germany). After 24 hours of incubation at 37 ° C, glycerol was added to the mixture of bacteria and broth medium in a ratio of 70 to 30. The resulting suspension was transferred to the Eppendorf and stored at -80 ° C.
8
Characterization of Thi-box Riboswitch
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nutrient agar, nutrient broth medium, NaCl, and dimethyl sulfoxide were obtained from Merck (Darmstadt, Germany), and streptomycin was supplied from Sigma (Taufkirchen, Germany). Deionized water was used for solutions. The thi-box riboswitch active site, with the sequence of 5′ GUGCCCUUCUGCGUGAAGGCUGAGAA 3′, was purchased from Eurofins Genomics (Ebersberg, Germany).
9
Synthesis and Characterization of Biomass Compounds
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sodium citrate, urea, and thiourea were purchased from Chemical Reagent Co. Ltd. (Tianjin, China). Xylose and glucose were purchased from Aladdin Ltd. (Shanghai, China). Nutrient broth (NB) medium (1 g L−1 yeast extract, 3 g L−1 beef extract, 5 g L−1 poly peptone, 10 g L−1 sucrose) was purchased from Sigma-Aldrich. All other chemicals were of analytical grade and used as received. Double distilled water was used in all experiments.
10
Halloysite Nanotubes in Polymer Composites
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Halloysite Nanotubes (HNTs) were supplied by NaturalNano (Rochester, NY, USA) and dried at 150 °C for 3 h prior to use. Low-density polyethylene (LDPE), Ipethene 320, is supplied by Carmel Olefins Ltd. (Haifa, Israel) with melt flow rate of 2 g/10 min. Carvacrol (1-methyl-4-(1-methylethylidene)cyclohexene, >97%, CAS 586-62-9), Yeast extract and Tryptone for Lysogeny broth (LB) medium, NaCl, Bacto agar, Nutrient Broth (NB) medium, Potato Dextrose Agar (PDA) are purchased from Sigma Aldrich (Rehovot, Israel). NB bacto-agar is purchased from Becton Dickinson (Sparks, MD, USA).
Ethylene vinyl alcohol (EVAL E105B), (EVOH) containing 44 mole percent of ethylene was purchased from Kuraray, Tokyo Japan. The properties reported by the manufacturer of the EVOH are a density of 1.11 g cm−3, a melting temperature of 165 °C, a glass transition temperature of 53 °C, and an oxygen transmission rate at 20 °C and a 65% relative humidity of 0.03 cc·mm/(m2·day).
Ethylene vinyl alcohol (EVAL E105B), (EVOH) containing 44 mole percent of ethylene was purchased from Kuraray, Tokyo Japan. The properties reported by the manufacturer of the EVOH are a density of 1.11 g cm−3, a melting temperature of 165 °C, a glass transition temperature of 53 °C, and an oxygen transmission rate at 20 °C and a 65% relative humidity of 0.03 cc·mm/(m2·day).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!