Primer 6

The total RNA of liver tissue in each group were extracted using TRIzol reagent (Sangon Biotech) according to the manufacturer’s instructions and then reverse transcribed into cDNA using RT reagent Kit with gDNA Eraser (Takara, China) according to the manufacturer’s instructions. The cDNA were used as the template for further quantitative RT-PCR analysis. A lightcycler real-time PCR system and the SYBR Green PCR Kit were used to conduct real-time PCR. Each sample had been measured in triplicate. The conditions of conducting the PCR reaction included: at the initial stage, denaturing at 95°C for 30 s, followed by 40 cycles of denaturing at 95°C for 5 s, annealing and extension at 60°C for 30 s. The primers of Nrf2, NAD(P)H:quinone oxidoreductase-l (NQO1), heme oxygenase-1(HO-1), glutamate–cysteine ligase catalytic subunit (GCLc), glutamate-cysteine ligase regulatory subunit (GCLm), and glutathione S-transferase (GSTO1) were designed by using Primer 6 software (PREMIER Biosoft company, Palo Alto, CA, United States) (Supplementary Table S1), and β-actin was employed as a house-keeping gene. To allow comparisons of mRNA expression levels, the real-time PCR data were analyzed by using the 2^−ΔΔCT assay and expressed as fold change relative to expression in the normal group.

We employed the MISA software (http://pgrc.ipk-gatersleben.de/misa/) to identify SSR markers within the unigene sequences, with a minimum repeat sequence length of 18 bp. Following the identification of SSR markers, we utilized Primer 6.0 software (Premier Biosoft International, Palo Alto, CA, USA) for primer design. The primer length ranged from 18 to 25 bp, ensuring optimal specificity. The melting temperature (Tm) value of the primers fell within the range of 52.0°C to 60.0°C, with a maximum difference of 5°C between the Tm values of the upstream and downstream primers. The (G + C) content of the primers was maintained between 40% and 60% to ensure stability and efficient amplification. Furthermore, the primer amplification length was designed to be within the range of 100 bp to 300 bp, providing a suitable target size for PCR amplification.

We randomly selected one sample (about 40 mg) in each batch of commercial crude drugs and 1–3 samples (200–300 mg) in each batch of Chinese patent medicines. The samples were ground into powder using a FastPrep bead mill (Retsch MM400). DNA was extracted from powder using the Plant Universal Genomic DNA Kit and amplified by ITS2F. (5′-ATGCGATACTTGGTGTGAAT-3′) /WWZ5R (5′-GCTCCTCGCAAACACCATAC-3′) primer pairs that were newly designed by Primer 6.0 software (Premier Biosoft International, Palo Alto, CA, USA) and specific for S. chinensis and its closely related species. The location of primer pairs is shown in Figure 2. PCR was performed in a 25 µL reaction system containing 2 µL (about 30 ng) of DNA templates, 1.0 µL of primer ITS2F/WWZ5R (2.5 µmol/L), 12.5 µL of 2× PCR Master Mix (Aidlab Biotechnologies Co., Ltd., Beijing, China), and double-distilled water. The reactions were performed with the same thermal program that was used for the other materials. Purified PCR products were sequenced in both directions with the newly designed primer pairs by the Sanger sequencing method on a 3730 XL sequencer (Applied Biosystems, Inc., Foster City, CA, USA).

The putative mutation was validated by Sanger sequencing in the proband and four family members. The following PCR primers were designed using Primer 6.0 software (PREMIER Biosoft International, CA, USA): forward (CAGGGCACTGGACCATTAGA) and reverse (CCCACTGGTGCATGAAAACTAA). PCR products were purified and sequenced on an ABI 3130XL (Applied Biosystems). The results are shown in Fig. 4.

The cDNA was synthesized using a HiScript II 1st Strand cDNA Synthesis Kit (Vazyme, Nanjing, China). The reverse transcription reactions began with 500 ng of total RNA. The resulting first stand cDNA was diluted 10-fold with ddH₂O, and then used as templates for qRT-PCR assays. The primers were designed for qRT-PCR by Primer 6.0 software (Premier Biosoft, Palo Alto, CA, USA). The internal reference gene was actin. The reaction system in the PCR of each primer was SYBR Green Mix 5 μL, primer (10 μM) 0.3 μL, cDNA 1 μL, and dd H₂O 3.4 μL. The PCR procedures were 50 °C 2 min, 95 °C 10 min, 95 °C 15 s, 65 °C 60 s, 72 °C (30 cycles), and 72 °C 10 min. The primers were synthesized by Sangon Biotech Co., Ltd. The relative quantitative method used the 2^-∆∆CT method [59 (link)]. Each sample had three biological replicates. The primer sequences are shown in Supplementary Table S2.