RAW-D cells or BMMs cultured in 60 mm dishes (2 × 105 cells/dish) for protein analysis or (1 × 105 cells/dish) for RNA analysis, were transfected with 10 pmol of one of two independent duplex siRNAs (Rab11b) covering the targeted sequences: 5′-GGGACGACGAGUACGAUUACCUAUU-3′ (Rab11b siRNA #1), or 5′-AAUAGGUAAUCGUACUCGUCGUCCC-3′ (Rab11b siRNA #2) (Invitrogen Custom Primers, Invitrogen, Carlsbad, CA, USA), or with 10 pmol of non-targeting siControl (siCtrl) (Stealth RNAi siRNA Negative Control, Invitrogen, Carlsbad, CA, USA) diluted in Opti-MEM I (Life Technologies) with Lipofectamine RNAiMAX transfection reagent (Invitrogen, Carlsbad, CA, USA) at 37 °C overnight, according to the manufacturer’s instructions. At the 1st day of post-transfection, the cells were replaced and cultured with new culture media containing RANKL (300 ng/mL) for 3 days. The knockdown efficacy was assessed by qPCR, immunoblotting, and TRAP staining where appropriate. Only for bone resorption analysis, after siRNA transfection, the cells were cultured with culture media supplemented with RANKL (500 ng/mL) for 7–10 days.
Custom primers
Manufactured by Thermo Fisher Scientific
Sourced in United States, Italy
Custom Primers are synthetic DNA sequences designed to serve as starting points for DNA amplification during various molecular biology techniques, such as PCR (Polymerase Chain Reaction). They are customized to target specific genetic regions of interest.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (4 mentions)
Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (3 mentions)
Lipofectamine rnaimax transfection reagent, by Thermo Fisher Scientific (2 mentions)
Cfx96, by Bio-Rad (2 mentions)
Icycler machine, by Bio-Rad (2 mentions)
Iq sybr green supermix, by Bio-Rad (2 mentions)
Beacon designer 3, by Bio-Rad (2 mentions)
Rpmi 1640, by Microgem (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Opti mem 1, by Thermo Fisher Scientific (1 mentions)
Scion image, by Techcomp Instruments (1 mentions)
Superscript 2, by Thermo Fisher Scientific (1 mentions)
Trizol, by Kinematica (1 mentions)
Polytron pt 1200, by Kinematica (1 mentions)
Hiscript 2 q select rt supermix for qpcr kit, by Vazyme (1 mentions)
Bl21 gold de3 cells, by Agilent Technologies (1 mentions)
Xl1 blue supercompetent cells, by Agilent Technologies (1 mentions)
L cysteine, by Merck Group (1 mentions)
Restriction enzyme, by New England Biolabs (1 mentions)
Fosfomycin disodium salt, by MP Biomedicals (1 mentions)
30 protocols using custom primers
1
Rab11b Knockdown in Osteoclastogenesis
2
RNA Isolation and cDNA Synthesis Across Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from INS-1 E cell line, purified pancreatic islets, purified acinar tissue, and rat brain were isolated using the RNeasy Lipid Tissue Mini Kit. cDNA from porcine tissues was generated using the VILO cDNA synthesis kit (from 1 μg of the isolated total RNA). Retro Transcription of total RNA from rat tissues and INS-1 E cells has been instead done using the 3′ RACE System for Rapid Amplification of cDNA Ends, according to the instructions provided by the manufacturer (from 4 μg of the isolated total RNA). To perform PCR assays the amount of cDNA obtained retro-transcribing 30 ng total RNA was used in each reaction for pig tissues, 100 ng of total RNA for rat brain and INS-1 E, and 250 ng for purified rat islets RNA. AccuPrime™ Pfx SuperMix was used for semiquantitative PCR assays at the conditions recommended by the manufacturer; varying the annealing temperature and the extension time on the basis of the couple of primers used. All the primers (Table S2 ) were synthesized by Invitrogen Custom Primers except for the AUAP (Abridged Universal Amplification Primer) that is included in the 3′ RACE System. The PCR products were run on a 2% agarose gel in 1X TAE buffer, stained with a 3X GelRed™ Nucleic Acid Gel Stain solution, imagined and quantified by densitometry using Alphaview software.
3
Lung RNA Extraction and RT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lungs were cut with a microtome, three sections being obtained for each sample for total RNA extraction with TRIZOL (Reagent InvitrogenTM Life Technologies) as in the phenol extraction method described by Chomczynsky. [19] (link) Microsections were added 1 ml TRIZOL and homogenized (Polytron PT 1200, Kinematica AG) and centrifuged at 10.000 rpm/10 min at 4°C. The supernatant was removed and RNA was precipitated by adding 0.1 volumes of sodium acetate 3 M, 2.5 volumes cold ethanol and 0.5 µl glycogen (20 mg/ml). RNA was centrifuged again, air-dried and resuspended in 20 µl Tris/EDTA buffer. RNA was reversely transcribed to cDNA with Superscript II (Invitrogen), by incubation with reverse transcriptase at 50°C for 30 min, followed by amplification with custom primers (Invitrogen), summarised in Table 1 . 35 amplification cycles were completed, with denaturalization at 95°C (30 sec), hybridization (30 sec) (temperatures on Table 1 ) and extension at 72°C (1 min). Following amplification, RT-PCR products were separated in agarose gels at 1% and bands were viewed by ethidium bromide staining, and quantified by band density scanning using Scion Image (Beta 4.02, Scion Corporation). Results were expressed in relation to the level of β-actin mRNA in the same RNA samples.
4
Enterovirus Detection via RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The throat swab specimens of caregivers were defrosted in a − 4 °C environment. Each 200 μl specimen was processed by using LogPure Viral RNA/DNA Kits (250 reactions) (Magen, Guangzhou, China). Lastly, 60 μl of viral RNA was extracted. Reverse transcription was conducted using a HiScript® II Q Select RT SuperMix for qPCR kit (Vazyme, Nanjing, China). The primers for enterovirus were designed on the basis of other literature [17 (link), 18 (link)]. Table 1 lists the details of the primers for enterovirus (Invitrogen Custom Primers, Shanghai). Next, 10 μl of 2 × qPCR mix (iQ™ SYBR® Green Supermix, Bio-Rad, America), 1 μl of forward primer, 1 μl of reverse primer, 1 μl of probe, 3 μl of tri-distilled water and 4 μl s of cDNA sample were added into each PCR tube. Afterwrad, Taqman real-time PCR was conducted with a quantitative fluorescence analyzer (Bio-rad CFX96, America). All experiments were performed in accordance with the manufacturer’s instruction. When the Ct value was greater than 20 or less than 40, corresponding specimens were considered positive.
Primers for the enterovirus real-time fluorescence quantitative PCR
| Primer Name | Sequence 5′-3’ | 3′ Label | 5′ Label | Size(bp) |
|---|---|---|---|---|
| CCCTGAATGCGGCTAATCC | ||||
| ATTGTCACCATAAGCAGCCA | ||||
| AACCGACTACTTTGGGTGTCCGTGTTTC | BHQ1 | FAM | 146 |
5
Purification and Characterization of FosB Enzyme
6
Quantifying ZIKV in Mosquito Saliva
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To compare plaque assays with quantitative reverse transcription PCR (RT-qPCR), we performed RT-qPCR on saliva samples from mosquitoes exposed to 105 and 106 PFU/mL at days 4 and 20 post-infection. Viral RNA was extracted from saliva samples (QIAamp Viral RNA Mini Kit, Qiagen) and reverse-transcribed to cDNA (High Capacity RNA-to-cDNA Kit, Applied Biosystems). ZIKV genome copies were measured with RT-qPCR reaction assay using TaqMan Gene Expression Master Mix (Applied Biosystems), primers (F: ZIKV 1086, R: ZIKV 1162c; Invitrogen Custom Primers) and probes (ZIKV 1107-FAM; TaqMan MGB Probe) [30 (link)]. Each sample was analyzed in duplicate, and each assay contained a standard curve (ZIKV molecular clone), no template, and no primer controls. We extrapolated ZIKV copy numbers from the generated standard curve using the Applied Biosystems protocol. The limit of detection was experimentally established to be 30 copies (10−16 g). Final copy numbers were adjusted by back-calculations to the total RNA and cDNA volume and expressed as copies per saliva sample.
7
Amplification of ClpB Protein Fragment
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from the cultures of the WT and ClpB mutant strains, and was also purified from mice feces using the QIAampR DNA Stool Mini Kit (Qiagen, Courtaboeuf, France). Bacteria were dissolved in water and boiled at 100 °C during 5 min, after 1 min of centrifugation at 11 000 r.p.m., the supernatant containing the DNA was stored at −20 °C. Using the NCBI primer design tool (http://www.ncbi.nlm.nih.gov/tools/primer-blast/ ), we designed the following nucleotide primers that amplify 180-base pair DNA region coding for the ClpB protein fragment containing one identified α-MSH-like epitope (Figure 1e ), forward: 5′-GCAGCTCGAAGGCAAAACTA-3′ and reverse: 5′-ACCGCTTCGTTCTGACCAAT-3′ (Invitrogen Custom Primers, Cergy Pontoise, France). PCR was performed in a thermocycler with MicroAmp tubes (Eppendorf, Hambourg, Germany). The reaction was carried out in a 50-μl volume containing 25 μl of Go Taq Green Master Mix 2 × (Promega), 1 μl (20 pmol) of each primer, 21 μl of bi-distilled water and 1 μl of bacterial DNA. PCR conditions were as follows: 3 min at 94 °C followed by 35 cycles at 94 °C for 30 s, 60 °C for 30 s and 72 °C for 1.5 min. PCR products were visualized on a 1% agarose gel (Sigma), with the expected size of 180 base pair and the specificity validated using ClpB mutant strain.
8
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was collected and purified using a RNeasy mini kit (QIAGEN) per the manufacturer’s protocol. The RNA concentration and quality were assessed with a ND-1000 NanoDrop spectrophotometer. For qRT-PCR, complementary DNA was synthesized with the iScript Reverse Transcription Supermix Kit (Bio-Rad) and the Eppendorf Mastercycler. Relative mRNA expression levels were measured using SYBR Green reagents (Bio-Rad) with an iCycler machine (Bio-Rad) and normalized to the glyceraldehyde-3-phosphate dehydrogenase housekeeping gene. Three technical replicates were carried out per condition, and custom primers (Invitrogen) are presented in table S1.
9
Isolation and Quantification of IECs
10
Kidney RNA Extraction and RT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from kidney tissue was extracted (at the 4 °C using a tissue homogenizer) by guanidinium thiocyanate-chloroform (Invitrogen, Carlsbad, USA), and isolated according to the manufacturer’s protocol. RNA quantity and purity was measured using NanoDrop 2000c spectrophotometer (Thermo-scientific, Wilmington, USA). cDNA synthesis was performed using M-MLV Reverse Transcriptase from 1 μl of total RNA according to the manufacturer’s protocol (Promega, Madison, USA). Analysis of mRNA expression by reverse transcription RT-PCR was carried out using standard protocols. The following RT-PCR cycle profile was used: 10 min at 95 °C, followed by 40 cycles of 15 s at 95 °C for denaturation, 20 s at 60 °C for combined annealing, and 10 s at 72 °C for extension. Real Time PCR was performed using the custom primers (Invitrogen, Carlsbad, USA) for β-actin (forward 5′-AGGAGTACGATGAGTCCGGCCC-3′ and reverse 5′-GCAGCTCAGTAACAGTCCGCCT-3′, accession number NM 031144.2) as housekeeping and TGF-β 1 (forward 5′-CAACCCGGGTGCTTCCGCAT-3′ and reverse 5′-TGCTCCACCTTGGGCTTGCG-3′, accession number NM 021578.2 ) as target gene.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!