Viiatm7

The total RNA was isolated by using TRIZOL reagent (Invitrogen, Mulgrave, Australia). The RNA was reversely transcribed into cDNA by RevertAid Reverse Transcriptase (EP0442; Thermo Scientific) according to the manufacturer's instructions. Real-time polymerase chain reaction (RT-PCR) was performed with SYBRPremix EX Taq (Takara, Dalian, China) by using ViiATM 7 (Life Technologies, Carlsbad, CA, USA). Primers used in this study were the following: LRG1, 5′-GGACACCCTGGTATTGAAAGAAA-3′ and 5′-TAGCCGTTCTAATTGCAGCGG-3′.

Total RNA from HepG2 cells treated with insulin or NaB for 24 h were extracted using a TRIzol reagent according to the manufacturer's protocol. Concentration of RNA was determined by a NanoDrop 2000 instrument (Bio-Rad, USA). cDNA was reverse-transcripted from RNA by a cDNA synthesis kit according to the protocol from the supplier as follows: priming for 5 min at 25°C, reverse transcription for 20 min at 46°C, and RT inactivation for 1 min at 95°C. Real-time PCR was performed by FastStart Universal SYBR Green Master. Each sample was mixed with 10 μl SYBR master mix, 2 μl primers (mixture with both forward and reverse primers), 0.1 μl cDNA, and DEPC-treated water to make up a total reaction volume of 20 μl. Mixtures were circulated for 40 cycles using a high-productivity real-time quantitative PCR ViiATM7 (Life Technologies, Gaithersburg, MD, USA). The reference gene was β-actin. Each experiment was repeated for at least three times. Sequences for primers used in PCR analysis are listed in Table 1.

The adherent cultured cell samples were extracted with 1 μg of total RNA by using TRIzol, reversely transcribed into cDNA by reverse transcription kit and subjected to RT-PCR detection using a ViiATM7 real-time PCR instrument (Applied Biosystems).
GSK-3β gene primer sequence is as follows:
Upstream 5′-3′: AGACGCTCCCTGTGATTTATGT
Downstream 5′-3′: CCGATGGCAGATTCCAAAGG
GAPDH primer sequence is as follows:
Upstream 5′-AGGCTGTGGGCAAGGTCATC-3^″Downstream 5′-TCAGGTCCACCACTGACACG-3′

Regular and FR L‐929 cells were exposed to 1 and 10 mm NaF for 12 h, and the RNeasy Mini Kit (Qiagen, Hilden, Germany) was then used to extract the total RNA. The quality and quantity of the RNA were analyzed with a NanoVue Plus (Biochrom US, Holliston, MA, USA). cDNA was synthesized from 500 ng of total RNA by using a QuantiTect Reverse Transcription Kit (Qiagen). The mRNA levels of Fas‐L were determined by qPCR (ViiA TM 7; Applied Biosystems, Thermo Fisher Scientific, Boston, MA, USA) using iTaq Universal SYBR Green Supermix (Bio‐Rad, Hercules, CA, USA). The forward primer for Fas‐L (5′ to 3′ direction) was TCCGTGAGTTCACCAACCAAA, and the reverse primer for Fas‐L (5′ to 3′ direction) was GGGGGTTCCCTGTTAAATGGG. The forward primer for GAPDH (5′ to 3′ direction) was AGGTCGGTGTGAACGGATTTG, and the reverse primer for GAPDH (5′ to 3′ direction) was GGGGTCGTTGATGGCAACA. The 2^−ddCt method was used to quantify target genes with GAPDH used as a reference gene.

First-strand cDNA synthesis was achieved by reverse transcription of RNA using iScript^TM reverse transcription supermix (Bio-Rad). cDNA served as template for amplification of genes of interest and housekeeping genes by RT-PCR, using SYBR Green MasterMix (Applied Biosystems) amplified and read using the ViiA^TM 7 real-time PCR machine. The primers used in this study are listed in Table S3. The Ct values were normalized using RPLPO, ACTB, and 16S as internal controls.

RNA was isolated using the 96 RNeasy kit (Qiagen), following the vacuum/spin protocol without the optional DNase treatment. RNA was eluted into nuclease-free water and quantified by ultraviolet absorbance using a NanoDrop 8000 (Thermo Scientific). cDNA synthesis was performed using the High Capacity RNA to cDNA Kit (Applied Biosystems) according to the manufacturer's recommendations. The cDNA was diluted 1:4 with nuclease-free water and 1 μl was added to a 10 μl Taqman reaction mixture prepared using the TaqMan Gene Expression Master Mix (Applied Biosystems). Taqman assays were performed on a ViiA^TM7 (Applied Biosystems) or a QuantStudio^TM 12K Flex Real Time PCR System (Applied Biosystems) using the following conditions: 50°C for 2 min; 95°C for 10 min; 40 cycles of 95°C for 15 s and 60°C for 1 min. Gene expression was normalized to the endogenous control GAPDH and RNU48 for mRNA and miRNA expression, respectively. Taqman primers and probes are listed in Supplementary Table S2.

RNA was isolated using the 96RNeasy kit (Qiagen), following the vacuum/spin protocol without the optional DNase treatment. RNA was eluted into nuclease-free water and quantified by ultraviolet absorbance using a NanoDrop 8000 (Thermo Scientific). cDNA synthesis was performed using the High Capacity RNA to cDNA Kit (Applied Biosystems) according to the manufacturer’s recommendations. The cDNA was diluted 1:4 with nuclease-free water and 2.5 μl was added to a 9 μl Taqman reaction mixture prepared using the TaqMan Gene Expression Master Mix (Applied Biosystems). Taqman assays were performed on a ViiATM7 (Applied Biosystems) or a QuantStudioTM 12K Flex Real Time PCR System (Applied Biosystems) using the following conditions: 50°C for 2 min; 95°C for 10 min; 40 cycles of 95°C for 15 s and 60°C for 1 min. Gene expression was normalized to the endogenous control GAPDH for mRNA expression. Taqman primers and probes are listed in Supplementary Table 4.