Tbe polyacrylamide gel

Manufactured by Thermo Fisher Scientific

Sourced in China, United States

The TBE (Tris-Borate-EDTA) polyacrylamide gel is a laboratory equipment used for the separation and analysis of nucleic acids, such as DNA and RNA, through gel electrophoresis. It provides a medium for the migration and separation of these biomolecules based on their size and charge.

Automatically generated - may contain errors

Lab products found in correlation

Hiseq 2000 platform, by Illumina (2 mentions) Sybr gold stain, by Thermo Fisher Scientific (2 mentions) Hiseq 2500 platform, by Illumina (2 mentions) Genejet whole blood genomic dna purification kit, by Thermo Fisher Scientific (2 mentions) Gelred stain, by Biotium (2 mentions) Realplex mastercycler 2, by Eppendorf (2 mentions) Truseq pe cluster kit v3, by Illumina (1 mentions) Truseq small rna sample preparation kit v2, by Illumina (1 mentions) Truseq sbs kit v3, by Illumina (1 mentions) Amplitaq dna polymerase, by Thermo Fisher Scientific (1 mentions) Ampure xp magnetic beads, by Beckman Coulter (1 mentions) Ampligase, by Illumina (1 mentions) Hiseq 2000, by Illumina (1 mentions) Gel doc ez imager, by Bio-Rad (1 mentions) Dsdna hs assay kit, by Thermo Fisher Scientific (1 mentions) Magzol reagent, by Magen Biotechnology Co (1 mentions) Agilent 2200 tapestation, by Agilent Technologies (1 mentions) Rna screentape, by Agilent Technologies (1 mentions) Truseq deep sequencing technology, by Illumina (1 mentions) Illustra probequant g 50 micro column, by GE Healthcare (1 mentions)

14 protocols using tbe polyacrylamide gel

Small RNA Profiling of SW480/SW620 Cells and EVs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Small RNA (18~30 nt) libraries for SW480/SW620 cells and derived EVs (sMVs and exosomes) were constructed using Illumina TruSeq Small RNA Sample Preparation Kit v2 and sequenced on a HiSeq 2000 platform (Illumina), according to the manufacturer’s protocols. Briefly, small RNAs (18~30 nt) were fractioned on a 15% Tris-borate-EDTA (TBE) polyacrylamide gel (Life Technologies, CA) from total RNA (200 ng), purified by centrifugation, and ligated with adaptors. Small RNAs were then reverse transcribed into cDNAs and amplified using the adaptor primers for 14 cycles. The cDNA fragments (~150 bp) were isolated from a 6% TBE PAGE-gel and directly used for cluster generation by using TruSeq PE Cluster Kit v3 (Illumina). Using TruSeq SBS Kit v3 (Illumina) biological replicates (n = 2) were sequenced for each sample.

Chen M., Xu R., Rai A., Suwakulsiri W., Izumikawa K., Ishikawa H., Greening D.W., Takahashi N, & Simpson R.J. (2019). Distinct shed microvesicle and exosome microRNA signatures reveal diagnostic markers for colorectal cancer. PLoS ONE, 14(1), e0210003.

+ Open protocol

+ Expand

Bisulfite Padlock Probe Sequencing Protocol

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Bisulfite padlock probe design, production and sequencing were previously described [16] (link), [43] (link). Briefly, genomic DNA was extracted from peripheral blood of 22 pedigrees, and approximately 1 µg of genomic DNA was bisulfite converted with EZ-96 Zymo DNA Methylation-Gold kit (Zymo Research). Approximately 250 ng of bisulfite converted genomic DNAs were mixed with normalized amount of genome-wide scale padlock probes and oligo suppressors. The padlock probes were annealed to bisulfite converted genomic DNA. The gap between two ends of padlock probes was filled and ligated with AmpliTaq DNA polymerase, Stoffel fragment (Life Technologies) and Ampligase (Epicentre), respectively resulting in circularized DNA. The bisulfite sequencing libraries were generated by library-free BSPP protocol as described [16] (link). Briefly, two-thirds of the circularized DNA of each captured reaction were directly amplified and barcoded with adapter primers compatible with Illumina sequencer. The bisulfite sequencing libraries were purified with AMPure XP magnetic beads (Agencourt), pooled in equimolar ratios, size selected at the size approximately 375 bp with 6% TBE polyacrylamide gel (Life Technologies), and sequenced by Illumina HiSeq2000 and GAIIx sequencers.

Plongthongkum N., van Eijk K.R., de Jong S., Wang T., Sul J.H., Boks M.P., Kahn R.S., Fung H.L., Ophoff R.A, & Zhang K. (2014). Characterization of Genome-Methylome Interactions in 22 Nuclear Pedigrees. PLoS ONE, 9(7), e99313.

+ Open protocol

+ Expand

RNA-Protein Binding Analysis via EMSA

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Radioactive EMSA assays (including radiolabeling of RRE and buffer preparation) were performed as previously described[24 (link)]. UV-visualized EMSA assays were adapted from previous protocols as follows[43 (link)]. 20 μL reaction mixtures containing varying DDX21 or Rev concentrations, 12.5nM RRE RNA, 1X reaction buffer (50mM Tris pH 7.5, 150mM KCl, 10% glycerol, 1% Triton X-100, 0.1 mg/mL BSA and 0.67U/μL RNaseOUT) and DEPC-treated H₂O were incubated at room temperature for 30 minutes to come to binding equilibrium. Reactions were then loaded onto a 10% TBE polyacrylamide gel (Invitrogen) and run for 2 hours at 200V. Gels were soaked in SYBRGold Stain (Invitrogen) for 30 minutes and RNA visualized using a BioRad Gel Doc EZ Imager™. Image contrast was adjusted slightly using photoshop (Adobe®).

Hammond J.A., Zhou L., Lamichhane R., Chu H.Y., Millar D.P., Gerace L, & Williamson J.R. (2017). A Survey of DDX21 Activity During Rev/RRE Complex Formation. Journal of molecular biology, 430(4), 537-553.

+ Open protocol

+ Expand

Placental EV miRNA Sequencing Workflow

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA in placental EVs or in placentae was extracted by Magzol reagent (Magen, Guangzhou, Guangdong, China) following the manufacturer’s instruction and the RNA concentration was then measured by Qubit (Life Technology, Carlsbad, CA, USA). MiRNA sequencing was conducted by Ribio Co., Ltd. (Shanghai, China). After the extraction of RNA from placental EVs, quality control was conducted by Qubit dsDNA HS Assay Kit (Life Technology, Carlsbad, CA, USA) and RNAScreenTape (Agilent Technology, Santa Clara, CA, USA) using Agilent 2200 TapeStation (Agilent Technology, Santa Clara, CA, USA). Total RNA was fractionated by 15% Tris-borate-EDTA (TBE) polyacrylamide gel (Invitrogen, Shanghai, China), and small RNA (18~30 nt) were gel purified, ligated, reverse transcribed and amplified for cDNA library preparation. Small RNA sequencing was performed by Illumina Hiseq 2500 platform following the Hiseq 2500 User Guide. The RNA sequencing was performed on placental EVs derived from six individual donors (healthy, n = 3, and missed miscarriage, n = 3).

Zhang Y., Tang Y., Liu Y., Wang J., Shen Y., Sun X., Kang M., Zhao M, & Chen Q. (2022). The Autocrine Role of Placental Extracellular Vesicles from Missed Miscarriage in Causing Senescence: Possible Pathogenesis of Missed Miscarriage. Cells, 11(23), 3873.

+ Open protocol

+ Expand

Small RNA Sequencing of Extracellular Vesicles

Check if the same lab product or an alternative is used in the 5 most similar protocols

Four small RNA libraries (from parental LIM1863 cells and derived sMVs, A33-, and EpCAM-Exos) were constructed and sequenced with Illumina TruSeq deep sequencing technology (Sample Preparation Guide, Par #15004197 Rev.A, Illumina, San Diego, CA). Briefly, total RNA samples were fractionated on a 15% Tris-borate-EDTA (TBE) polyacrylamide gel (Invitrogen) and a bands corresponding to small RNAs (18∼30 nt) were excised and small RNAs extracted by centrifugation. After ligation of 5′(5′-GUUCAGAGUUCUACAGUCCGACGAUC-3′) and 3′(5′-UGGAAUUCUCGGGUGCCAAGG-3′) adaptors, small RNA molecules were reverse transcribed into cDNA, then amplified using the adaptor primers for 14 cycles and the fragments (∼150 bps) were isolated from a 6% TBE PAGE-gel. The purified cDNA was directly used for cluster generation and sequenced using an Illumina HiSeq 2000 platform. Image files generated by the sequencer were processed to produce digital-quality data (raw FASTQ files). FASTQ files for all four small RNA libraries (LIM1863 cells, and derived sMVs, A33-Exos and EpCAM-Exos) have been submitted to Sequence Read Archive (SRA) of NCBI under the accession number SRA106214.

Ji H., Chen M., Greening D.W., He W., Rai A., Zhang W, & Simpson R.J. (2014). Deep Sequencing of RNA from Three Different Extracellular Vesicle (EV) Subtypes Released from the Human LIM1863 Colon Cancer Cell Line Uncovers Distinct Mirna-Enrichment Signatures. PLoS ONE, 9(10), e110314.

+ Open protocol

+ Expand

Exosomal miRNA Library Preparation

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the preparation and sequencing of miRNA libraries, total RNA from exosomes from A549 and BEAS-2B cells was extracted. Briefly, the total RNA samples were fractionated using a 15% Tris-borate-EDTA (TBE) polyacrylamide gel (Invitrogen), and small RNAs of 18–30 nt were applied for library preparation. Small RNAs were reverse transcribed and amplified using PCR. The PCR products were subjected to sequencing via the Illumina HiSeq 2500 platform (RiboBio, Guangzhou, China).^{39 (link)}

Huang W., Yan Y., Liu Y., Lin M., Ma J., Zhang W., Dai J., Li J., Guo Q., Chen H., Makabel B., Liu H., Su C., Bi H, & Zhang J. (2020). Exosomes with low miR-34c-3p expression promote invasion and migration of non-small cell lung cancer by upregulating integrin α2β1. Signal Transduction and Targeted Therapy, 5, 39.

+ Open protocol

+ Expand

Radiolabeled DNA-protein Binding Assay

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA fragments (see S3 Table) containing oriC_Mtb [33 (link)] and rrnAPL [19 (link)] were amplified by PCR and products were gel-purified using QIAquick column (Qiagen). 250 ng of gel-purified dsDNA or 3x FLAG ssDNA oligo (see S3 Table) were labeled with T4 polynucleotide kinase (NEB) and [γ-³²P]-ATP, and unincorporated [γ-³²P]-ATP was removed using Illustra ProbeQuant G-50 microcolumns (GE Healthcare). 20,000 cpm of labeled probe, 10 μg BSA, and the indicated amounts of DciA_Mtb or DciA_Mtb^W113A were mixed with buffer (50mM Tris-HCl pH7, 150mM NaCl, 1mM EDTA, 1mM DTT) in a total volume of 12μl and incubated for 20 minutes at room temperature. Samples underwent native electrophoresis in 4–20% nondenaturing TBE polyacrylamide gels (Invitrogen). The gels were dried and exposed to film for detection by autoradiography.

Mann K.M., Huang D.L., Hooppaw A.J., Logsdon M.M., Richardson K., Lee H.J., Kimmey J.M., Aldridge B.B, & Stallings C.L. (2017). Rv0004 is a new essential member of the mycobacterial DNA replication machinery. PLoS Genetics, 13(11), e1007115.

+ Open protocol

+ Expand

CarD Binding to M. smegmatis rrnA Promoter

Check if the same lab product or an alternative is used in the 5 most similar protocols

A DNA fragment containing the M. smegmatis rrnA promoter and leader sequences, called rrnAPL and corresponding to M. smegmatis mc²155 nucleotides 5029577 – 5029909, was used for EMSAs as previously described (Srivastava et al., 2013 (link)). The DNA (250 ng) was amplified with IRDye labeled primers. 1pmol of labeled DNA, 1μg of LightShift Poly(di/dc) competitor DNA (Thermo Scientific), 10 μg BSA, and 200 pmol of CarD proteins were mixed with binding buffer (20 mM Tris, pH 8, 150 mM NaCl) in a total volume of 20 μL and incubated for 20 min at room temperature. Samples were then electrophoresed on 4–20% nondenaturing TBE polyacrylamide gels (Invitrogen) and imaged using an Odyssey CLX imaging system (LI-COR).

Garner A.L., Weiss L.A., Manzano A.R., Galburt E.A, & Stallings C.L. (2014). CarD integrates three functional modules to promote efficient transcription, antibiotic tolerance, and pathogenesis in mycobacteria. Molecular microbiology, 93(4), 682-697.

+ Open protocol

+ Expand

Genotyping VDBP Alleles by RFLP

Check if the same lab product or an alternative is used in the 5 most similar protocols

Three VDBP alleles were analyzed: Gc1F (rs7041-T/rs4588-C), Gc1S (rs7041-G/rs4588-C) and Gc2 (rs7041-T/rs4588-A) (7 (link)). DNA was extracted from blood using the GeneJet Whole Blood Genomic DNA Purification kit (Thermo Fisher, Waltham, MA). Genotypes were then determined by restriction-fragment length polymorphism (RFLP) analyses, as previously described (21 (link)). Briefly, DNA was amplified by PCR using a Realplex Mastercycler2 (Eppendorf, Hauppauge, NY) and oligonucleotide primers: Forward, 5’TATGATCTCGAAGAGGCATG3’; Reverse, 5’AATCACAGTAAAGAGGAGGT3’ (synthesized by Integrated DNA Technologies, Coralville, IA; GenBank L10641.1). PCR amplicons were then treated with either HaeIII or StyI restriction enzymes that cleave at Gc1S or Gc2 polymorphic sites, respectively. Resulting fragments were separated on 4–12% TBE polyacrylamide gels (Invitrogen, Carlsbad, CA) and visualized by GelRed stain (Biotium, Fremont, CA) to assign one of six possible genotypes based on fragment sizes. RFLP analyses were repeated for any samples with unclear results; also, random samples were repeated for quality control. PCR reagents and enzymes were from New England Biolabs (Ipswich, MA).

Newton D.A., Baatz J.E., Kindy M.S., Gattoni-Celli S., Shary J.R., Hollis B.W, & Wagner C.L. (2019). Vitamin D binding protein polymorphisms significantly impact vitamin D status in children. Pediatric Research, 86(5), 662-669.

+ Open protocol

+ Expand

VDBP Allele Analysis by RFLP

Check if the same lab product or an alternative is used in the 5 most similar protocols

Three VDBP alleles were analyzed: Gc1F (rs7041-T/rs4588-C), Gc1S (rs7041-G/rs4588-C), and Gc2 (rs7041-T/rs4588-A).^{7 (link)} DNA was extracted from blood using the GeneJet Whole Blood Genomic DNA Purification kit (Thermo Fisher, Waltham, MA, USA). Genotypes were then determined by restriction-fragment length polymorphism (RFLP) analyses, as previously described.^{21 (link)} Briefly, DNA was amplified by PCR using a Realplex Mastercycler2 (Eppendorf, Hauppauge, NY, USA) and oligonucleotide primers: forward, 5′-TATGATCTCGAAGAGGCATG-3′; reverse, 5′-AATCACAGTAAAGAGGAGGT-3′ (synthesized by Integrated DNA Technologies, Coralville, IA, USA; GenBank L10641.1). PCR amplicons were then treated with either HaeIII or StyI restriction enzymes that cleave at Gc1S or Gc2 polymorphic sites, respectively. Resulting fragments were separated on 4–12% TBE polyacrylamide gels (Invitrogen, Carlsbad, CA, USA) and visualized by GelRed stain (Biotium, Fremont, CA, USA) to assign one of six possible genotypes based on fragment sizes. RFLP analyses were repeated for any samples with unclear results; also, random samples were repeated for quality control. PCR reagents and enzymes were from New England Biolabs (Ipswich, MA, USA).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!