Log In Sign up
The largest database of trusted experimental protocols

Acetylated h4

Manufactured by Merck Group
Visit Supplier
Sourced in Germany

Acetylated H4 is a laboratory reagent used in scientific research. It is a modified form of the histone protein H4, with acetylation modifications on specific lysine residues. Acetylated H4 is used as a tool to study chromatin structure and epigenetic regulation of gene expression.

Automatically generated - may contain errors

Lab products found in correlation

Acetylated h3, by Merck Group (4 mentions) Acetylated h3k27, by Abcam (2 mentions) Acetylated tubulin, by Merck Group (1 mentions) Total h4, by Abcam (1 mentions) α tubulin, by Merck Group (1 mentions) Rna polymerase 2, by Santa Cruz Biotechnology (1 mentions) Nf κb p65 subunit, by Abcam (1 mentions) Stat1, by Abcam (1 mentions)

Spelling variants of this product

Acetylated histone H4 (5 citations) Acetylated histone 4 (Ac‐H4; (3 citations) Acetylated histone H4 (Ac-H4; (3 citations) Anti-acetylated histone H4 (2 citations) Anti-acetylated histone H4 K16 (2 citations)

5 protocols using acetylated h4

1

Chromatin Immunoprecipitation of Acetylated Histones

Check if the same lab product or an alternative is used in the 5 most similar protocols
Acetylation at inflammatory gene promoters was measured by chromatin immunoprecipitation (ChIP) assay. Promoters are defined as the region between −500 bp and the transcription start site. Antibodies used were as follows: acetylated H3 (Millipore 06–599), acetylated H3K27 (Abcam ab4729), acetylated H4 (Millipore 06–866), and IgG (Santa Cruz, Dallas, TX, SC-2027). Fold enrichment was calculated as ChIP signals normalized to input. Technical triplicates were analyzed for each condition tested.
Langston P.K., Nambu A., Jung J., Shibata M., Aksoylar H.I., Lei J., Xu P., Doan M.T., Jiang H., MacArthur M.R., Gao X., Kong Y., Chouchani E.T., Locasale J.W., Synder N.W, & Horng T. (2019). Glycerol phosphate shuttle enzyme GPD2 regulates macrophage inflammatory responses. Nature immunology, 20(9), 1186-1195.
+ Open protocol
+ Expand
2

Chromatin Immunoprecipitation of Acetylated Histones

Check if the same lab product or an alternative is used in the 5 most similar protocols
Acetylation at inflammatory gene promoters was measured by chromatin immunoprecipitation (ChIP) assay. Promoters are defined as the region between −500 bp and the transcription start site. Antibodies used were as follows: acetylated H3 (Millipore 06–599), acetylated H3K27 (Abcam ab4729), acetylated H4 (Millipore 06–866), and IgG (Santa Cruz, Dallas, TX, SC-2027). Fold enrichment was calculated as ChIP signals normalized to input. Technical triplicates were analyzed for each condition tested.
Langston P.K., Nambu A., Jung J., Shibata M., Aksoylar H.I., Lei J., Xu P., Doan M.T., Jiang H., MacArthur M.R., Gao X., Kong Y., Chouchani E.T., Locasale J.W., Synder N.W, & Horng T. (2019). Glycerol phosphate shuttle enzyme GPD2 regulates macrophage inflammatory responses. Nature immunology, 20(9), 1186-1195.
+ Open protocol
+ Expand
3

Protein Extraction and Western Blot

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were lysed directly in 6X SDS loading buffer (histone western blots) or in 1% NP-40 buffer (all other western blots). Protein concentration was determined using the Bradford method. Primary antibodies were purchased from Cell Signaling except for α-Tubulin (Sigma), acetylated Tubulin (Sigma), acetylated H3 (Millipore, Germany), acetylated H4 (Millipore), and total H4 (Abcam, Cambridge, MA).
Covarrubias A.J., Aksoylar H.I., Yu J., Snyder N.W., Worth A.J., Iyer S.S., Wang J., Ben-Sahra I., Byles V., Polynne-Stapornkul T., Espinosa E.C., Lamming D., Manning B.D., Zhang Y., Blair I.A, & Horng T. (2016). Akt-mTORC1 signaling regulates Acly to integrate metabolic input to control of macrophage activation. eLife, 5, e11612.
+ Open protocol
+ Expand
4

ChIP Assay for Histone Modifications

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP was done as described (Byles et al., 2013 (link)), using acetylated H3 (Millipore 06–599), acetylated H4 (Millipore 06–866), or IgG (Santa Cruz, Dallas, TX, SC-2027) antibodies. Fold enrichment was calculated as ChIP signals normalized to input. ChIP primer sequences as well as position relative to transcription start site (TSS) are provided in Supplementary file 2.
Covarrubias A.J., Aksoylar H.I., Yu J., Snyder N.W., Worth A.J., Iyer S.S., Wang J., Ben-Sahra I., Byles V., Polynne-Stapornkul T., Espinosa E.C., Lamming D., Manning B.D., Zhang Y., Blair I.A, & Horng T. (2016). Akt-mTORC1 signaling regulates Acly to integrate metabolic input to control of macrophage activation. eLife, 5, e11612.
+ Open protocol
+ Expand
5

Chromatin Immunoprecipitation (ChIP) Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were treated with 1% formaldehyde to crosslink chromatin. Fixed cells were incubated with lysis buffer and sonicated using a Bioruptor® device (Diagenode UCD400). 5% of sonicated cell lysates was saved as input. Chromatin was immunoprecipitated using antibodies to STAT1 (Abcam), Histone 4 (H4), acetylated H4 (Millipore), NF-κB p65 subunit (Abcam) and RNA Polymerase II (Santa Cruz Biotechnology). Crosslinks were reversed, DNA was purified and enrichment of the target DNA was measured by real time PCR. The human oligonucleotide primers used were:
CXCL10 Promoter: 5-GTGCTGAGACTGGAGGTTCC-3 and 5- GGGAGGGAAAATGGCTTTGC -3; Hemoglobin b (HBB) Promoter: 5- GAGGGCTGAGGGTTTGAAGT-3 and 5-TGCTCCTGGGAGTAGATTGG-3.
Sohn C., Lee A., Qiao Y., Loupasakis K., Ivashkiv L.B, & Kalliolias G.D. (2015). Prolonged TNFα primes fibroblast-like synoviocytes in a gene-specific manner by altering chromatin. Arthritis & rheumatology (Hoboken, N.J.), 67(1), 86-95.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!