Plasmid contains wild-type ICER coding sequence (corresponding to GenBank. AJ311667.1) was kindly gifted by Dr Shogo Endo38 (link), and subcloned into pIRES2-DsRed-Express vector (Clontech Laboratories Inc.). Following oligonucleotide sequences were used: 5′- TGATCTCGAGCATGGCTGTAACTGGAGATG -3′; and 5′- TGCTGGATCCCGTTACTCTACTTTATGGCAAT -3′. ICERγ overexpression vector and N′-FLAG-tagged overexpressing vectors were generated using Q5 site-directed mutagenesis kit (New England Biolabs). Following oligonucleotide sequences were used: 5′- CTGCCACAGGTGACATGCCAAC -3′; and 5′- CAGTTTCATCTCCAGTTACAGC -3′. For generating N′-FLAG-tagged overexpressing plasmid, FLAG sequence (DYKDDDDK) were inserted N′ terminal of ICER-overexpressing plasmid or ICERγ-overexpressing plasmid. Following oligonucleotide sequences were used: 5′- GACGATGACAAGGCTGTAACTGGAGATGAAAC -3′; and 5′- ATCCTTGTAGTCCATCCTCGAGATCTGAG -3′. All constructs were validated by DNA sequencing. All procedures were performed according to the manufacturer's instructions.
Pires2 dsred express vector
Manufactured by Takara Bio
Sourced in United States
The PIRES2-DsRed-Express vector is a plasmid that contains the DsRed-Express gene, which encodes a variant of the Discosoma sp. red fluorescent protein (DsRed). The vector also includes the IRES2 sequence, which allows for the internal ribosome entry site-driven expression of the DsRed-Express gene.
Automatically generated - may contain errors
3 protocols using pires2 dsred express vector
1
Plasmid construction for ICER overexpression
2
Transposon Vectors for Genetic Manipulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To generate the transposon vectors, we first generated a pT2/shp53/shNf1/polyA vector. This vector was generated by inserting the H1 promoter‐shRNA expression cassette excised from pSUPER.retro.puro vector, and BGH‐polyA sequence PCR‐amplified from pL453 vector into pT2/Onc2 vector23 digested with HindIII and StuI. To generate pT2/shp53/shNf1/SV40‐GFP vector (NP vector), SV40‐GFP cassette was PCR‐amplified from pT2/shp53/GFP4 vector (Addgene, Cambridge, MA, USA), and inserted into pT2/shp53/shNf1/polyA vector. To generate pT2/shp53/shNf1/CMV‐PDGFA‐IRES‐DsRed vector (PNP vector), we introduced EcoRV sites upstream of the CMV promoter in pIRES2‐DsRed‐Express vector (Clontech, Mountain View, CA, USA). PDGFA was PCR‐cloned from the cDNA isolated from SW480 cell line, and inserted into pIRES2‐DsRed‐Express vector. The CMV‐PDGFA‐IRES‐DsRed sequence was excised, and inserted into pT2/shp53/shNf1/polyA vector. SB1123 was inserted into pMXs‐IRES‐Puro vector (Cell Biolabs, San Diego, CA, USA). pT2/CMV‐PDGFA‐IRES‐DsRed vector (P vector) was generated by inserting the CMV‐PDGFA‐IRES‐DsRed sequence into pT2/polyA backbone. pT2/CAG‐EGFP vector (GFP vector) was generated by inserting the CAG‐EGFP‐polyA sequence into pT2 backbone. We used the previously reported shRNA for Nf1 (5′‐GGACACAATGAGATTAGAT‐3′)24 and Trp53 (5′‐GTACATGTGTAATAGCTCC‐3′).7
3
Generation and Characterization of A549-hNIS Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The A549-hNIS cell lines were generated by selecting for stable transfectants after plasmid transfection. Primers were designed based on the cDNA sequence SLC5A5 (Entrez Nucleotide, National Center for Biotechnology Information, Bethesda, MD) and amplified from a human cDNA clone (ATCC 11047241) to form a 1,932 basepair insertion into the multiple cloning site (MCS) of the pIRES2DsRedExpress vector (Clontech, Mountain View, CA). The IRES2DsRedExpress vector is a bicistronic expression vector that is driven by a constitutively active human cytomegalovirus promoter located upstream of the MCS and includes a neomycin-resistance cassette to allow for G418 selection. The modified vector was transfected into A549 cells using the FuGene 6 reagent (Promega, Madison, WI) according to the manufacturer’s protocol. Modified clones were plated in serial dilution and selected using 500 μg/ml of G418 (VWR, Radnor, PA, USA) for 2 weeks. Transiently transfected cells were also generated using the FuGene 6 reagent. A549-pDNA clones were screened for 99mTcO4- uptake activity and cells with the highest uptake were chosen for subsequent in vivo studies.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!