Pcdna3.1 ms2 tet1 cd

CRISPR-Cas9 vector px549 was obtained from Lienhard Schmitz (Giessen, Germany) and adapted for epigenetic editing by inactivation of Cas9 (dCas9 site-directed mutation). ZAR1 guide RNAs/Oligos were positioned/generated using Benchling (Additional file 1: Figure S1a) [70 ] and cloned into px549-dCas and TET1 through the BbsI site. Epigenetic modifier plasmids were ordered from Addgene and modified if indicated: pcDNA-dCas9-p300 Core (61357), pdCas9-DNMT3A-EGFP (71666) with deletion of U6 promoter (site-directed mutagenesis), pdCas9-Tet1-CD (83340) as wildtype, with deletion of U6 promoter (site-directed mutagenesis) or as wildtype with cloned ZAR1 guides in BbsI restriction site (ZAR1-guided-TET1), pcDNA3.1-MS2-Tet1-CD (83341), Ezh2[SET]-dCas9 (100087), DNMT3A-dCas9 (100090). Epigenetic editing of endogenous ZAR1 was performed in the ZAR1 partially methylated Hela, if not mentioned otherwise. ZAR1 RNA guides are #1 ACTTTCGCTCACTTAGCCAG, #2 TGGTTCCCTTACGGATCAGC, #3 GTAGGGAGAAGGACGAAGAG, #4 GTCGCCTATTTAGGGTGCGG, #5 CGCGGCCACCAAGGGCAAGG, and #6 CCGCGGTACAGTGCTCGCTG and are positioned relative to TSS at −402 #1, −230 #2, −133 #3, −3 #4, +120 #5, and +386 #6.

The plasmids utilized for transient transfections in this study were pcDNA™3.1 (+) empty vector Zeo backbone (Invitrogen, Cat. No. V790-20); pUC19 sgRNA cloning backbone with MS2 loops at tetraloop and stem-loop 2 that contains BbsI sites for insertion of spacer sequences (Addgene plasmid # 61424, a gift from Feng Zhang); MS2-p65-HSF1_GFP (Addgene plasmid # 61423, a gift from Feng Zhang); SP-dCas9-VPR (Addgene plasmid # 63798, a gift from George Church); pdCas9-Tet1-CD and pcDNA3.1-MS2-Tet1-CD (Addgene plasmids # 83340 and # 83341, respectively, a gift from Ronggui Hu); and pcDNA-dCas9 (Addgene plasmid # 47106, a gift from Charles Gersbach).
The plasmids utilized for lentiviral transductions in this study were pMD2.G (VSV-G envelope expressing plasmid) and the third generation packaging pMDLg/pRRE (GAG and POL expressing plasmid) (Addgene plasmids # 12259 and # 12251, respectively, a gift from Didier Trono), pLV hU6-sgRNA hUbC-dCas9-VPR-T2A-Puro [19 (link)], and pLV hU6-sgRNA hUbC-dCas9-TET1-CD-T2A-Puro (this paper, see Molecular cloning section).

A list of plasmids with links to their Addgene entries are provided in Supplementary Table 1. Detailed descriptions and sequences of oligonucleotides and proteins are given in the Supplementary Tables 2-5. The plasmids pCAG-dCas9-5xPlat2AflD and pCAG-scFvGCN4sfGFPTET1CD (Addgene #82560 and 82561, respectively), pdCas9-Tet1-CD, and pcDNA3.1-MS2-Tet1-CD (Addgene #83340 and 83341, respectively) were gifts from Izuho Hatada and Ronggui Hu, respectively.