The largest database of trusted experimental protocols

Plkd cmv g pr u6 shrna vector

Manufactured by Obio Technology
Sourced in China

The PLKD-CMV-G&PR-U6-shRNA vector is a plasmid-based system for the expression of short hairpin RNA (shRNA) in mammalian cells. It contains a CMV promoter for the expression of a gene of interest, as well as a U6 promoter for the expression of the shRNA. The vector also includes a GFP and puromycin resistance cassette for selection and identification of transfected cells.

Automatically generated - may contain errors

3 protocols using plkd cmv g pr u6 shrna vector

1

Modulation of Adipogenic and Osteogenic Differentiation in 3T3-L1 Preadipocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols
3T3-L1 preadipocytes were purchased from a cell bank at the Chinese Academy of Sciences (Shanghai, China). Cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM, high-glucose, HyClone, USA) containing 10% fetal bovine serum (FBS, Invitrogen, USA). 3T3-L1 preadipocytes were transfected with the pLKD-CMV-G&PR-U6-shRNA vector and the PGMLV-CMV-KINDLIN2-HA-PGK-blasticidin vector which were purchased from OBiO Technology (Shanghai, China) and Genomeditech (Shanghai, China), respectively. The pLKD-CMV-G&PR-U6 vector and the PGMLV-CMV-HA-PGK-blasticidin were used as negative controls. The transfection efficiency was examined by western blot and real-time polymerase chain reaction (RT-PCR). For induction of adipogenic differentiation, cells were cultured in adipogenic differentiation medium kit (Cyagen, Suzhou, China). After being cultured for 21 days according to the protocol, cells were fixed in 4% paraformaldehyde solution for 30 minutes and then stained with Oil Red O (Cyagen, Suzhou, China) for 30 minutes at room temperature. For induction of osteogenic differentiation, cells were cultured in osteogenic differentiation medium kit (Cyagen, Suzhou, China). After being cultured for 21 days according to the protocol, cells were fixed in 4% paraformaldehyde solution for 30 minutes and then stained with Alizarin Red (Cyagen, Suzhou, China) for 5 minutes at room temperature.
+ Open protocol
+ Expand
2

Silencing FERMT2 in Melanoma Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
HUVECs, HaCaT cells and six melanoma cell lines, namely, A2058, A375, A875, MV3, M14 and sk-mel-28 (shown as SK28), were purchased from a cell bank at the Chinese Academy of Sciences (Shanghai, China). These cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) or RPMI-1640 medium (HyClone, USA) containing 10% foetal bovine serum (FBS, Invitrogen, USA). The pLKD-CMV-G&PR-U6-shRNA vector and the pLenti-EF1a-mcherry-P2A-Puro-CMV-MCS-3Flag vector were purchased from Obio Technology Corp. (Shanghai, China). The pLKD-CMV-G&PR-U6-shRNA lentiviral vector was transfected into SK28 cells (target sequence GCCTCAAGCTCTTCTT GAT), and the pLKD-CMV-G&PR-U6 vector was used as a negative control. The pLenti-EF1a-mcherry-P2A-Puro-CMV-FERMT2-3Flag vector was transfected into A375 cells, and the pLenti-EF1a-mcherry-P2A-Puro-CMV-MCS-3Flag vector was used as a negative control. The transfection efficiency was examined by western blotting and qRT-PCR.
+ Open protocol
+ Expand
3

Overexpression and Knockdown of circCOG8 in NP Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
For the circCOG8 overexpression, exon 3 of human COG8 gene (828 bp) with approximate 1 kb flanking introns containing complementary Alu elements were amplified to construct the recombinant adenovirus vector (Obio Technology, Shanghai, China), as described previously (Zhang et al., 2014 (link)). For the lentiviral circCOG8 shRNA construction, oligonucleotides with the circCOG8 targeting sequences were inserted to the pLKD-CMV-G&PR-U6-shRNA vector (Obio Technology, Shanghai, China). Targeting sequence for circCOG8: CCAAGGGCATCGTGAACGA, negative control sequence: TTCTCCGAACGTGTCACGT. MiR-182-5p mimic, miR-182-5p inhibitor, as well as their corresponding negative controls, were produced by the GenePharma, Corp. FOXO3 siRNA (targeting sequence: GCATGTTCAATGGGAGCTTGGA) and its control siRNA was purchased from the Obio Technology, Corp. The NP cells were cultured with six-well plates to 70–80% confluence and then, the cell transfection was achieved by the Lipofectamine 3000 transfection reagent (Invitrogen, United States), according to the merchant guide.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!