Cfx96 real time detection system

Manufactured by Bio-Rad

Sourced in United States, Japan, China, Germany, Canada, India, United Kingdom

The CFX96 Real-Time Detection System is a qPCR (quantitative Polymerase Chain Reaction) instrument manufactured by Bio-Rad. The system is designed to perform real-time detection and quantification of nucleic acid sequences.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (40 mentions) Iscript cdna synthesis kit, by Bio-Rad (26 mentions) Rneasy mini kit, by Qiagen (20 mentions) Trizol, by Thermo Fisher Scientific (19 mentions) Iq sybr green supermix, by Bio-Rad (18 mentions) Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (16 mentions) Primescript rt reagent kit with gdna eraser, by Takara Bio (14 mentions) Primescript rt reagent kit, by Takara Bio (14 mentions) Cfx manager software, by Bio-Rad (11 mentions) Nanodrop 2000, by Thermo Fisher Scientific (10 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (10 mentions) Kapa sybr fast qpcr kit, by Roche (9 mentions) Ssofast evagreen supermix, by Bio-Rad (9 mentions) Nanodrop spectrophotometer, by Thermo Fisher Scientific (9 mentions) Rnaiso reagent, by Takara Bio (8 mentions) Itaq universal sybr green supermix, by Bio-Rad (8 mentions) M mlv reverse transcriptase, by Thermo Fisher Scientific (8 mentions) Rnaiso plus reagent, by Takara Bio (7 mentions) Gotaq qpcr master mix, by Promega (7 mentions) Itaq universal sybr green supermix kit, by Bio-Rad (7 mentions)

330 protocols using cfx96 real time detection system

RNA Isolation and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated from the samples using Nucleospin RNA kit (Macherry-Nagel, Germany). 1 μg of isolated total RNA for each sample was used to synthesize c-DNA using Bioradi-Script cDNA synthesis Kit. Bio-Rad CFX 96™Real-Time Detection System was used for real-time PCR (qRT-PCR) using i-TaqSyber green (Bio-Rad, USA)
according to manufacturer’s instruction. In case of qPCR array, 1 µg of isolated RNA was used to synthesize cDNA using RT² first strand kit (QIAGEN, SA Biosciences, USA). The real-time PCR array was then performed using RT²Syber Green Master Mix (QIAGEN, SA Biosciences, USA) on 96 well plate of customized qRT-PCR array plate. The qRT-PCR reaction was performed according to the manufacturer’s protocol and Bio-Rad CFX 96™- Real Time Detection System (Bio-Rad, USA was used. The data thus obtained were then analyzed using RT² Profiler™ PCR Array Data Analysis Web-based tool (QIAGEN, SA Biosciences, USA) having following URL: http://pcrdataanalysis.sabiosciences.com/pcr/arrayanalysis.php.

Rana S., Maurya S., Mohapatra G., Singh S., Babar R., Chandrasekhar H., Chamoli G., Rathore D., Kshetrapal P, & Srikanth C.V. (2021). Activation of epigenetic regulator KDM6B by Salmonella Typhimurium enables chronic infections. Gut Microbes, 13(1), 1986665.

+ Open protocol

+ Expand

Quantitative analysis of IFNB1 and HIV-1

Check if the same lab product or an alternative is used in the 5 most similar protocols

mRNA expression of IFNB1 was analyzed by real-time RT-PCR using gene-specific primer/probe pairs (Life Technologies). A GAPDH (human)-PCR using specific primer/probe pairs (Life Technologies) served as internal control to quantify the relative gene expression of target genes. The iScript One-Step RT-PCR Kit for Probes (BioRad) was used for target amplification and runs were performed on the CFX96 real-time detection system (BioRad). The cycling conditions were as follows: 10 min@50°C (RT), 3 min@95°C, 40 cycles: 5 sec@95°C, 15 sec@60°C. The results were analyzed using the gene expression software of the cycler (CFX Manager Software, ΔΔCt method) [60 (link)]. Primers and method for HIV-1 dynamics was performed as described [7 (link)]. Briefly, integrated HIV-1 levels were determined by a nested PCR comprising an Alu-HIV-1 PCR as first step, followed by a second PCR the first cDNA products and R/U5 primers and probe set. Thermal cycling conditions for R/U5 and full-length HIV-DNA consisted of 95°C@10 min and 40 cycles of 15 s@95°C and 30 s@60°C. The Alu-HIV-1 PCR was performed at 95°C for 10 min followed by 22 cycles of 30 s at 95°C, 30 s at 66°C, 10 min at 70°C, and a final extension step of 10 min at 72°C. All real-time PCR runs were performed on the CFX96 real-time detection system (Bio-Rad).

Posch W., Steger M., Knackmuss U., Blatzer M., Baldauf H.M., Doppler W., White T.E., Hörtnagl P., Diaz-Griffero F., Lass-Flörl C., Hackl H., Moris A., Keppler O.T, & Wilflingseder D. (2015). Complement-Opsonized HIV-1 Overcomes Restriction in Dendritic Cells. PLoS Pathogens, 11(6), e1005005.

+ Open protocol

+ Expand

Quantifying Liver Transgene and Preneoplasia

Check if the same lab product or an alternative is used in the 5 most similar protocols

Vector genome copies present in liver extracts were determined by qPCR using iQ™ SYBR® Green (BioRad) in a CFX96 Real-Time Detection System (BioRad) with primers specific for the A1AT liver promoter. Mouse GAPDH (glyceraldehyde-3-phosphate dehydrogenase) was used as a normalizing gene (primers listed in Supplementary Table 1).
To analyse transgene and preneoplasia marker expression, total RNA was isolated from livers using the Maxwell® 16 LEV simplyRNA Tissue Kit (Promega) according to manufacturer’s instructions and quantified. Extracted RNA was reverse transcribed into complementary DNA (cDNA) using M-MLV reverse-transcriptase (Invitrogen). qPCR was performed using TaqMan primers and probes specific for codon-optimized-MDR3 (FAM, NFQ-MGB) and mouse GADPH (VIC, NFQ-MGB) or mouse albumin (FAM, NFQ-MGB) designed by Applied Biosystems (sequences of which were not provided to the researchers) and run on a ViiA 7 (ThermoFisher). For neoplasia markers, qPCR was performed with iQ™ SYBR Green (BioRad) in a CFX96 Real-Time Detection System (BioRad) (primers listed in Supplementary Table 1) using GAPDH as a normalizing gene.

Weber N.D., Odriozola L., Martínez-García J., Ferrer V., Douar A., Bénichou B., González-Aseguinolaza G, & Smerdou C. (2019). Gene therapy for progressive familial intrahepatic cholestasis type 3 in a clinically relevant mouse model. Nature Communications, 10, 5694.

+ Open protocol

+ Expand

Quantifying Vector Genome and Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Vector genome copies present in liver extracts were determined by qPCR using iQ™ SYBR^® Green (BioRad) in a CFX96 Real-Time Detection System (BioRad) with primers specific for the EAlbAAT liver promoter. Mouse Gapdh (glyceraldehyde-3-phosphate dehydrogenase) was used as housekeeping gene.
To analyze gene expression, total RNA was isolated from livers using the Maxwell^® 16 LEV simplyRNA Tissue Kit (Promega) according to the manufacturer’s instructions and quantified. Extracted RNA was reverse-transcribed into complementary DNA (cDNA) using M-MLV reverse-transcriptase (Invitrogen). Copies of hASS1 cDNA were determined by qPCR using GoTaq qPCR Mastermix (Promega) in a CFX96 Real-Time Detection System (BioRad). Mouse histone expression levels were used for normalization.
Primers used were: human EAlbAAT promoter: 5′-CCCTGTTTGCTCCTCCGATA-3′ and 5′-GTCCGTATTTAAGCAGTGGATCCA-3′; human ASS1: 5′-TCGTGTGGCTGAAGGAACAA-3′ and 5′-AAGAGAGGTGCCCAGGAGGTAG-3′. Gapdh 5′-TGCACCACCAACTGCTTA-3′ and 5′-GGATGCAGGGATGATGTTC-3′; Histone: 5′-AAAGCCGCTCGCAAGAGTGCG-3′ and 5′- ACTTGCCTCCTGCAAAGCAC-3′, Gfap: 5’-GACCAGCTTACGGCCAACAG-3′ and 5’-TCTCCTCCTCCAGCGATTCA-3’, Iba1: 5′-GTCCTTGAAGCGAATGCTGG-3′ and 5′-ATAGCTTTCTTGGCTGGGGG-3′

Bazo A., Lantero A., Mauleón I., Neri L., Poms M., Häberle J., Ricobaraza A., Bénichou B., Combal J.P., Gonzalez-Aseguinolaza G, & Aldabe R. (2022). Gene Therapy in Combination with Nitrogen Scavenger Pretreatment Corrects Biochemical and Behavioral Abnormalities of Infant Citrullinemia Type 1 Mice. International Journal of Molecular Sciences, 23(23), 14940.

+ Open protocol

+ Expand

AAV Transduction and Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

200000 Hela cells were seeded in M6 wells and next day they were infected with a m.o.i. of 2E5 vg/cell with the corresponding AAV vectors. 72 hours later they were harvested for molecular analysis or for immunofluorescence visualization of the AAV particles.
Vector genome copies present in cells were determined by qPCR using iQ™ SYBR® Green (BioRad) in a CFX96 Real-Time Detection System (BioRad) with primers specific for the CMV promoter (F 5’ TTACCATGGTGATGCGGTT; R 5’ TACACGCCTACCGCCCATT). Mouse Gapdh (glyceraldehyde-3-phosphate dehydrogenase) (F 5’ TGCACCACCAACTGCTTA R 5’ GGATGCAGGGATGATGTTC) was used as housekeeping gene.
To analyze transgene expression, total RNA was isolated from cell using the Maxwell® 16 LEV simplyRNA Tissue Kit (Promega) according to the manufacturer’s instructions and quantified. Extracted RNA was reverse transcribed into complementary DNA (cDNA) using M-MLV reverse-transcriptase (Invitrogen). Copies of GFP (F 5’ ATGGTGAGCAAGGGCGAGGA; R 5’ TTGCCGGTGGTGCAGATGAA) cDNA were determined by qPCR using GoTaq qPCR Mastermix (Promega) in a CFX96 Real-Time Detection System (BioRad). Mouse histone expression levels were used for normalization (F 5’ AAAGCCGCTCGCAAGAGTGCG; R 5’ ACTTGCCTCCTGCAAAGCAC).

Milagros S., de Erenchun P.R., Guembe M., Carte B., Méndez M., Uribarri A, & Aldabe R. (2024). The infectivity of AAV9 is influenced by the specific location and extent of chemically modified capsid residues. Journal of Biological Engineering, 18, 34.

+ Open protocol

+ Expand

Quantitative Analysis of circRNAs in Honey Bees

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

cDNA was synthesized using the Evo M-MLV Plus cDNA synthesis kit. All the eight DECs were selected for junction region and qRT-PCR verification with their sequence-specific primers (Table 1). The qRT-PCR was performed using the SYBR^® Green Pro Taq HS Master Mix qPCR Kit II (Accurate Biology). qPCR reactions were performed in two steps on the Bio-Rad CFX96 Real-Time Detection System (Bio-Rad Laboratories, Inc., United States): 95°C for 30 s; 95°C for 5 s, and 60°C for 30 s, 40 cycles; and adding a dissolution curve of 95°C for 1 min, 62°C for 30 s, and 95°C for 30 s. The 2^−ΔΔCT method was used to calculate the relative expression levels of circRNAs. A. mellifera ligustica AmAct (Kim et al., 2013 (link)) was used as a control. Three biological replicates were used for each group of samples, and each biological replicate was tested with three technical replicates.

Xueqing S., Delong L., Guizhi W., Yunhan F., Liuxu Y, & Tianle C. (2023). Effect of fluvalinate on the expression profile of circular RNA in brain tissue of Apis mellifera ligustica workers. Frontiers in Genetics, 14, 1185952.

+ Open protocol

+ Expand

Immune Gene Expression in Murine Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols

Hundred milligram of spleen specimens and brains specimens were collected with the same procedure as previously described in the section of “Western blotting.” Total cellular RNA was isolated from 100 mg of tissue specimens using the RNAiso plus Reagent (TaKaRa, Japan), and subsequently transcripted into cDNA using PrimeScript™ RT reagent Kit (Takara, RR047A, Dalian, China) according to the manufacturer's protocol. The mRNA levels of immune genes, including RIG-I, MDA5, TLR3, IFN-α, IFN-β, IFN-γ, IL-1β, IL-6, and IL-8, were detected by qRT-PCR which was performed using the Bio-Rad CFX96 Real-Time Detection System (Bio-Rad, USA), and the β-actin was as the housekeeping gene. Additionally, viral copies were detected by previously established methods in our laboratory (Zhang et al., 2019b (link)). The sequences of the gene-specific primers used for qRT-PCR are shown in Table 1.

Hu Z., Pan Y., Cheng A., Zhang X., Wang M., Chen S., Zhu D., Liu M., Yang Q., Wu Y., Zhao X., Huang J., Zhang S., Mao S., Ou X., Yu Y., Zhang L., Liu Y., Tian B., Pan L., Rehman M.U., Yin Z, & Jia R. (2020). Autophagy Is a Potential Therapeutic Target Against Duck Tembusu Virus Infection in vivo. Frontiers in Cellular and Infection Microbiology, 10, 155.

+ Open protocol

+ Expand

Circulating miRNA Isolation and Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Circulating miRNA was isolated from 300 µL of plasma using NucleoSpin miRNA Plasma (Macherey-Nagel, Germany) following the manufacturer’s protocol. Before isolation 25 fm of synthetic miR-39 from C. elegans miRNA (Institute of Biochemistry and Biophysics, Polish Academy of Sciences) was added to each sample. qScript microRNA cDNA Synthesis Kit (Quantabio, MA, USA) was used for first strand cDNA synthesis; we used 4 µL of each sample for cDNA synthesis. miRNA expression was assessed using qPCR performed with Bio-Rad CFX96 Real-Time Detection System (Bio-Rad, CA, USA). Reaction solution was as follows: 1 µL of cDNA sample, iQ SYBR Green Supermix (Bio-Rad, CA, USA), Universal Primer from qScript micrRNA Synthesis Kit, specific forward primer for analyzed miRNA. Quantification of the target miRNA expression value was expressed as 2∆Ct and NormFinder algorithm was used to find the best reference gene. Ct results were normalized to spike-in C. elegans miRNA and miR-223-5p.

Ulańczyk Z., Sobuś A., Łuczkowska K., Grabowicz A., Mozolewska-Piotrowska K., Safranow K., Kawa M.P., Pałucha A., Krawczyk M., Sikora P., Matczyńska E., Machaliński B, & Machalińska A. (2019). Associations of MicroRNAs, Angiogenesis-Regulating Factors and CFH Y402H Polymorphism—An Attempt to Search for Systemic Biomarkers in Age-Related Macular Degeneration. International Journal of Molecular Sciences, 20(22), 5750.

+ Open protocol

+ Expand

Quantifying TRIM25 Expression in Geese

Check if the same lab product or an alternative is used in the 5 most similar protocols

First, the cDNA used to clone the full length TRIM25 and the mRNA used to assess the transcription levels were synthesized using the same procedures described above. Then, the qRT-PCR analysis was conducted to determine the TRIM25 transcription levels in the different organs of the experimental geese and the treated GEFs and PBMCs. Two gene-specific primers (sense primer G-TRIM25-RT-F and reverse primer G-TRIM25-RT-R (Table 1)) that amplified a 127 bp TRIM25 fragment were designed to detect the transcription levels of TRIM25. Two other primers amplifying a 172 bp β-actin fragment served as an internal control. The qRT-PCR reaction mixture contained 5 μL of EvaGreen qPCR MasterMix (Abm, Canada), 0.3 μL of each primer (10 pmol/μL), 0.4 μL of cDNA, and 4 μL of sterile water. The qRT-PCR was performed using the Bio-Rad CFX96 Real-Time Detection System (Bio-Rad, USA). The goose TRIM25 qRT-PCR procedure was as follows: 95°C for 3 min, followed by 39 cycles of 95°C for 10 s, 57°C for 30 s (61°C for β-actin). Finally, the qRT-PCR data were analyzed using the 2^−ΔΔCT method with Bio-Rad CFX Manager Software.

Wei Y., Zhou H., Wang A., Sun L., Wang M., Jia R., Zhu D., Liu M., Yang Q., Wu Y., Sun K., Chen X., Cheng A, & Chen S. (2016). TRIM25 Identification in the Chinese Goose: Gene Structure, Tissue Expression Profiles, and Antiviral Immune Responses In Vivo and In Vitro. BioMed Research International, 2016, 1403984.

+ Open protocol

+ Expand

Quantification of DENV-1 Genotypes and Lineages

Check if the same lab product or an alternative is used in the 5 most similar protocols

Viral RNA from all samples (body, head/legs/wings, and saliva) was extracted with the QIAamp Viral RNA mini kit (Qiagen, Hilden, Germany). The detection and quantification of DENV-1 genotypes I and IV (DENV-1 GI and GIV) and DENV-1, genotype I, lineages 3 and 4 (DENV-1 L3 and L4) was performed by specific TaqMan quantitative RT–PCR assays with the Superscript III Platinum One-Step RT-qPCR kit (ThermoFisher Scientific, Carlsbad, CA, USA). Genotype or lineage-specific primers and probes, respectively targeting the NS2B or E gene for New Caledonian or Cambodian strains, were used (Supplementary Table 2). Amplifications were performed on either a LightCycler 480 instrument II (Roche, Basel, Switzerland) or a Bio-Rad CFX96 Real-Time Detection System (Bio-Rad, Hercules, CA, USA) using the following programme: one cycle (50°C, 15 min; 95°C, 2 min) followed by 45 cycles (95°C, 15 s; 57°C, 1 min).

O’Connor O., Ou T.P., Aubry F., Dabo S., Russet S., Girault D., In S., Minier M., Lequime S., Hoem T., Boyer S., Dussart P., Pocquet N., Burtet-Sarramegna V., Lambrechts L., Duong V, & Dupont-Rouzeyrol M. (2021). Potential role of vector-mediated natural selection in dengue virus genotype/lineage replacements in two epidemiologically contrasted settings. Emerging Microbes & Infections, 10(1), 1346-1357.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!