The mRNA expression levels of inflammatory mediators in the lung and BEAS-2B cells were determined through real-time quantitative PCR. Sepasol®-RNA I Super G (Nacalai Tesque Inc., Kyoto, Japan), an acid guanidinium thiocyanate-phenol-chloroform extraction reagent, was used to extract total RNA from lung tissue or BEAS-2B cells. Single-strand cDNA was synthesized from 2.0 μg total RNA by reverse transcription using ReverTra Ace® qPCR RT Master Mix with gDNA Remover kits (TOYOBO Co., Ltd., Osaka, Japan). Amplification of cDNA was performed by quantitative PCR, using THUNDERBIRD® SYBR® qPCR Mix (TOYOBO) with specific primers to measure the mRNA expression. Glyceraldehyde-3-phosphate dehydrogenase (murine: Gapdh, human: GAPDH) was used as a housekeeping gene. The sequences of murine and human primer were listed in Supplementary Tables S1, S2 . In this study, relative quantitative standard curve method was employed to calculate the mRNA expression of the target gene. Data were considered reliable when the R2 value was great than 0.99, and reaction efficiency was 90%–110%.
Sepasol rna 1 super g
Manufactured by Nacalai Tesque
Sourced in Japan, Spain, United States, Germany
Sepasol-RNA I Super G is a reagent used for the extraction and purification of RNA from various biological samples. It functions as a complete solution for the isolation of high-quality RNA, enabling efficient and reproducible results.
Automatically generated - may contain errors
Lab products found in correlation
Thunderbird sybr qpcr mix, by Toyobo (33 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (29 mentions)
Revertra ace, by Toyobo (28 mentions)
Revertra ace qpcr rt master mix, by Toyobo (20 mentions)
Primescript rt reagent kit, by Takara Bio (13 mentions)
Revertra ace qpcr rt kit, by Toyobo (11 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (9 mentions)
Superscript vilo cdna synthesis kit, by Thermo Fisher Scientific (9 mentions)
Rneasy mini kit, by Qiagen (8 mentions)
Thermal cycler dice real time system, by Takara Bio (8 mentions)
Bca protein assay kit, by Thermo Fisher Scientific (8 mentions)
Revertra ace qpcr rt master mix with gdna remover, by Toyobo (7 mentions)
Fast sybr green master mix, by Thermo Fisher Scientific (6 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (6 mentions)
Primescript rt master mix, by Takara Bio (6 mentions)
Superscript 4 first strand synthesis system for rt pcr, by Thermo Fisher Scientific (6 mentions)
Superscript 3, by Thermo Fisher Scientific (5 mentions)
Tb green premix ex taq 2 tli rnaseh plus, by Takara Bio (5 mentions)
Gdna remover, by Toyobo (5 mentions)
Thermal cycler dice real time system 2, by Takara Bio (5 mentions)
257 protocols using sepasol rna 1 super g
1
Quantifying Inflammatory Mediator mRNA
2
qRT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were extracted from cells using Sepasol-RNA I Super G (Nacalai Tesque) and first stranded cDNAs were synthesized using PrimeScript II Reverse Transcriptase (Takara) with oligo dT primer. Quantitative RT-PCR (qRT-PCR) was carried out using KAPA SYBR FAST (KAPA Biosystems) and sets of gene-specific primers on StepOnePlus Real-Time PCR System (Thermo Fisher Scientific). Relative RNA levels were analyzed by the ΔΔCt method according to the manufacturer’s protocol and normalized to the values of ACTB. Student’s t-test was used for statistical analysis and P < 0.05 was considered statistically significant. Sequences of primers used in this study are listed in Supplementary Table 4 .
3
Unbiased TCRβ Sequencing of CD8+ T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from pooled LNs-derived CD8+ T cells (1.0 × 105–106 cells/sample) and mixed with Sepasol RNA I SuperG (Nacalai Tesque) after positive selection using the MACS® Cell Separation Kit (Miltenyi Biotec, Bergisch Gladbach, Germany). Next-generation sequencing for the TCRβ analysis was performed at the Repertoire Genesis Incorporation (Osaka, Japan) using the unbiased gene amplification method with Adaptor-Ligation PCR by Miseq (Illumina, Inc., San Diego, CA, USA).
4
Reverse Transcription and qPCR for NEAT1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Following recovery of total RNA with Sepasol-RNA I Super G (Nacalai), complementary DNA was reverse-transcribed with reverse transcription primers (Table S2 ) by ReverTra Ace (Toyobo, Otsu, Japan) according to the manufacturer’s instructions. The human and mouse NEAT1v1-specific reverse transcription primers were designed based on the PolyA-seq data (GSE30198) [49 (link)], which revealed a major poly(A) site of NEAT11v1 in human and mouse livers. qPCR was performed on ViiA 7 Real-time PCR System (Thermo Fisher Scientific) by using THUNDERBIRD SYBR qPCR Mix (Toyobo) with primers shown in Supplementary Table S2 . β-actin was used as an internal control for calculation of relative mRNA expression levels. For comparison of monolayer cells and spheroids, hypoxanthine phosphoribosyltransferase 1 (HPRT1) was used as an internal control instead of β-actin, whose expression level is readily affected by the culture conditions.
5
Quantitative RT-PCR Analysis of Xcl1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were obtained using the Sepasol RNA-I Super G (Nacalai tesque), reverse transcribed and analysed by an ABI PRISM 7000 (Applied Biosystems). TaqMan probes (TaqMan Gene Expression Assay; Applied Biosystems) were used for 18S rRNA (internal control). The following SYBR Green primers were used: Xcl1 (Forward 5′- TTTGTCACCAAACGAGGACTAAA-3′, Reverse 5′-CCAGTCAGGGTTATCGCTGTG-3′). Gene expression was normalized to that of 18S rRNA and is represented as the ratio relative to the indicated reference samples. All primers were validated for linear amplification.
6
Profiling Retinal Cell Transcriptomes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Retinas (E17) were electroporated with either control or shSetd1a plasmid and cultured for 2 days. EGFP positive cells (∼3e4 cells for 1 sample) were collected by a cell sorter, FACS Aria II (BD Biosciences) as described.26 (link) Total RNA of three control and four shSetd1a samples was extracted using Sepasol RNA I Super G (Nacalai tesque) and quantified by using a 2100 Bioanalyzer (Agilent Technologies). Using 1 ng of total RNA, cDNA was prepared and amplified by PCR by SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara) according to the manufacturer's instructions. The RNA-Seq libraries were prepared using the amplified cDNA and Nextera XT DNA Sample Preparation Kit (Illumina). 36 bp of single read sequencing was conducted by HiSeq3000 sequencer (Illumina). The GEO accession number of RNA-Seq data is GSE154498.
7
Quantitative Analysis of ICAM-1 mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sepasol®-RNA I Super G (Nacalai Tesque, Kyoto, Japan) was used to extract total RNA. RNA (1 µg) was used to convert cDNA by ReverTra Ace® (TOYOBO, Osaka, Japan). cDNA was used as a template for quantitative-PCR using SYBR® Premix Ex TaqTM II (Tli RNaseH Plus) (Takara Bio, Kusatsu, Japan) and the following primers: 5′-GCCTGGGAACAACCGGAAGGTG-3′ and 5′-GGGTGCCAGTTCCACCCGTTC-3′ for the 148-bp fragment of ICAM-1 [41 (link)] and 5′-GGACATCCGCAAAGACCTGTA-3′ and 5′-GCTCAGGAGGAGCAATGATCT-3′ for the 143-bp fragment of β-actin [42 (link)]. PCR was performed with Thermal Cycler Dice® Real Time System Lite (Takara Bio, Kusatsu, Japan) under the following conditions: 94 °C for 3 min, followed by 45 cycles of 95 °C for 5 s, 58 °C for 30 s, and 72 °C for 30 s. The quantity of initial mRNA was calculated from primer-specific standard curves.
8
Quantitative RT-PCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was prepared from samples using extraction reagent (Sepasol‐RNA I Super G; Nacalai Tesque, Kyoto, Japan), and cDNA was synthesized by reverse transcription using the ReverTra Plus kit (Toyobo, Osaka, Japan). The expression levels of target genes were analyzed using a 7500 Fast Real‐Time PCR machine (Applied Biosystems, Foster City, CA, USA) with Thunderbird SYBR qPCR Mix (Toyobo). Experiments were carried out in triplicate and data were calculated using the ΔCt method. The sequences of the primers used for quantitative RT‐PCR are shown in Table 1 .
9
Quantifying RNA Expression Changes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted by using Sepasol-RNA I Super G (Nacalai Tesque). qRT-PCR reactions were carried out by using a One Step TB Green PrimeScript RT-PCR Kit (Takara), the appropriate primer set (Supplementary Table S1 ), and a StepOnePlus Real Time PCR System (Thermo Fisher Scientific). Unlike the standard procedure based on a reference gene, total RNA samples prepared from the same number of cells were subjected to qRT-PCR and compared directly, because there were no genes that were not affected by RPB6 knockdown.
10
Real-Time qPCR of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using the RNeasy Mini Kit (Qiagen, Venlo, Netherlands) or Sepasol‐RNA I Super G (Nacalai Tesque, Kyoto, Japan). First‐strand cDNAs were synthesized by PrimeScript 1st strand cDNA Synthesis Kit (Takara Bio Inc.) or ReverTra Ace ‐α‐ (TOYOBO, Osaka, Japan) with the respective random primers supplied by the manufacturer. qRT‐PCR analyses were carried out using FastStart Universal SYBR Green Master (ROX) (Roche Applied Science, Upper Bavaria, Germany) or THUNDERBIRD SYBR qPCR Mix (TOYOBO), and the StepOne Plus Real‐Time PCR System (Applied Biosystems, Foster City, CA, USA). The expression of each gene was normalized by hypoxanthine phosphoribosyl transferase 1 (Hprt1) gene expression. The primer sequences used in this study were as follows: GTTCTTTGCTGACCTGCTGGAT and CTTTTATGTCCCCCGTTGACTG for murine Hprt1, GTCCGCCCTGAGCAAAGA and TCCAGCAGGACCATGTGATC for eGFP, AAGTCCATCTACATGGCCAAGAA and TCCAGCTTGGAGTCCACGTAGT for DsRed, and TTCTCCTGGCTGTGAACACTGT and CACGGCTCAAGGGTTCCAT for murine Fas.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!